Accession | MIMAT0000650 |
Description | mmu-miR-17-3p mature miRNA |
Hairpins | |
Sequence | ACUGCAGUGAGGGCACUUGUAG |
Evidence |
experimental
cloned [3,5], Illumina [6-7] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25472717 | has_input UniProtKB:Q925B0 |
involved_in | GO:0010628 positive regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25472717 | has_input UniProtKB:P15116 |
involved_in | GO:0010628 positive regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25472717 | has_input UniProtKB:P20263 |
involved_in | GO:0010628 positive regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25472717 | has_input UniProtKB:P05533 |
involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25472717 | has_input UniProtKB:A0A0R4IZW5 |
involved_in | GO:0010718 positive regulation of epithelial to mesenchymal transition |
ECO:0000303 author statement without traceable support used in manual assertion |
PMID:25472717 | |
involved_in | GO:0035278 miRNA-mediated gene silencing by inhibition of translation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25472717 | has_input UniProtKB:Q925B0 |
involved_in | GO:0048146 positive regulation of fibroblast proliferation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25472717 | occurs_in CL:0002548 |
involved_in | GO:1901299 negative regulation of hydrogen peroxide-mediated programmed cell death |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25472717 | occurs_in CL:0002548 |
involved_in | GO:2000773 negative regulation of cellular senescence |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25472717 | occurs_in CL:0002548 |