Accession | MIMAT0000565 |
Description | mmu-miR-328-3p mature miRNA |
Hairpins | |
Sequence | CUGGCCCUCUCUGCCCUUCCGU |
Evidence |
experimental
cloned [2-3], Illumina [4-5] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
involved_in | GO:0002027 regulation of heart rate |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21098446 | |
involved_in | GO:1904878 negative regulation of calcium ion transmembrane transport via high voltage-gated calcium channel |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21098446 | occurs_in CL:0000746 |
involved_in | GO:1905001 negative regulation of membrane repolarization during atrial cardiac muscle cell action potential |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21098446 |