Accession | MIMAT0000538 |
Description | mmu-miR-31-5p mature miRNA |
Hairpins | |
Sequence | AGGCAAGAUGCUGGCAUAGCUG |
Evidence |
experimental
cloned [1-2], Illumina [3-4] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:1905907 negative regulation of amyloid fibril formation |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:32069773 | occurs_in UBERON:0002421 |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:32069773 | |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:32069773 | has_input UniProtKB:P56818 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:32069773 | has_input UniProtKB:P56818 |