Accession | MIMAT0000510 |
Description | hsa-miR-320a-3p mature miRNA |
Hairpins | |
Sequence | AAAAGCUGGGUUGAGAGGGCGA |
Evidence |
experimental
cloned [1-4], Illumina [5] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:0008285 negative regulation of cell population proliferation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31432141 | occurs_in CL:2000060 |
acts_upstream_of | GO:0030336 negative regulation of cell migration |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31432141 | occurs_in CL:2000060 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26395742 | has_input UniProtKB:O14786 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31432141 | has_input UniProtKB:P05112 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:32271402 | has_input UniProtKB:Q99717 |
involved_in | GO:0010666 positive regulation of cardiac muscle cell apoptotic process |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | |
involved_in | GO:0032713 negative regulation of interleukin-4 production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31432141 | occurs_in CL:2000060 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26395742 | has_input UniProtKB:O14786 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31432141 | has_input UniProtKB:P05112 |
involved_in | GO:0035279 miRNA-mediated gene silencing by mRNA destabilization |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:32271402 | has_input UniProtKB:Q99717 |
involved_in | GO:0045668 negative regulation of osteoblast differentiation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:32271402 | occurs_in CL:0002540 |
involved_in | GO:0090051 negative regulation of cell migration involved in sprouting angiogenesis |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | occurs_in CL:0010008 |
located_in | GO:0005615 extracellular space |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26646931 | part_of UBERON:0001969 |
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
Disease | Differential expression | Experiment | Year | Study |
---|