Mature sequence cbr-miR-248

Accession numberMIMAT0000504
IDcbr-miR-248
Stem-Loop cbr-mir-248
Sequence
uacacgugcucggauaacgcuca
Get sequence
Deep sequencing reads, experiments

References