Mature sequence cbr-miR-87

Accession numberMIMAT0000492
IDcbr-miR-87
Stem-Loop cbr-mir-87
Sequence
gugagcaaaguuucaggugu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:11679672 "An extensive class of small RNAs in Caenorhabditis elegans" Lee RC, Ambros V Science. 294:862-864(2001).