Mature sequence cbr-miR-86

Accession numberMIMAT0000491
IDcbr-miR-86
Stem-Loop cbr-mir-86
Sequence
uaagugaaugcuuugccacaguc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).