Mature sequence cel-miR-266

Accession numberMIMAT0000322
IDcel-miR-266
Stem-Loop cel-mir-266
Sequence
aggcaagacuuuggcaaagc
Get sequence
Deep sequencing1891 reads, 14 experiments
Predicted targets

References

1
PMID:12769849 "Computational and experimental identification of C. elegans microRNAs" Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM, Ruvkun G, Kim J Mol Cell. 11:1253-1263(2003).
2