Mature hsa-miR-182-5p
| Accession | MIMAT0000259 |
| Description | hsa-miR-182-5p mature miRNA |
| Hairpins | |
| Sequence | UUUGGCAAUGGUAGAACUCACACU |
| Evidence |
experimental
cloned [2-3] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| acts_upstream_of | GO:0040029 epigenetic regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28855441 | occurs_in CL:0000235 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:19188590 | has_input UniProtKB:O75030 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23226455 | has_input UniProtKB:Q13485 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23823476 | has_input UniProtKB:Q969H0 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28855441 | has_input UniProtKB:Q9UKV0 |
| involved_in | GO:0001819 positive regulation of cytokine production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28855441 | occurs_in CL:0000235 |
| involved_in | GO:0010628 positive regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23823476 | has_input UniProtKB:P36956 |
| involved_in | GO:0030335 positive regulation of cell migration |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:19188590 | |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:19188590 | has_input UniProtKB:O75030 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23226455 | has_input UniProtKB:Q13485 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28855441 | has_input UniProtKB:Q9UKV0 |
| involved_in | GO:0035278 miRNA-mediated gene silencing by inhibition of translation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23823476 | has_input UniProtKB:Q969H0 |
| involved_in | GO:0042632 cholesterol homeostasis |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28855441 | occurs_in CL:0000235 |
| involved_in | GO:0045542 positive regulation of cholesterol biosynthetic process |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:23823476 | |
| involved_in | GO:0045723 positive regulation of fatty acid biosynthetic process |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:23823476 | |
| involved_in | GO:0071397 cellular response to cholesterol |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23823476 | |
| involved_in | GO:1901224 positive regulation of non-canonical NF-kappaB signal transduction |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28855441 | occurs_in CL:0000235 |
| involved_in | GO:1904036 negative regulation of epithelial cell apoptotic process |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:19188590 | |
| involved_in | GO:1904706 negative regulation of vascular associated smooth muscle cell proliferation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28259995 | |
| involved_in | GO:1904753 negative regulation of vascular associated smooth muscle cell migration |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28259995 | |
| involved_in | GO:1905175 negative regulation of vascular associated smooth muscle cell dedifferentiation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28259995 | |
| located_in | GO:0005615 extracellular space |
ECO:0007005 high throughput direct assay evidence used in manual assertion |
PMID:26646931 | part_of UBERON:0001969 |
StarBase
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
| Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
|---|
miR2Disease
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
| Disease | Differential expression | Experiment | Year | Study |
|---|
