Mature sequence hsa-miR-208a-3p

Accession numberMIMAT0000241
IDhsa-miR-208a-3p
Previous IDshsa-miR-208
Stem-Loop hsa-mir-208a
Sequence
auaagacgagcaaaaagcuugu
Get sequence
Deep sequencing10637 reads, 29 experiments
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).