Accession | MIMAT0000239 |
Description | mmu-miR-206-3p mature miRNA |
Hairpins | |
Sequence | UGGAAUGUAAGGAAGUGUGUGG |
Evidence |
experimental
cloned [1-2], Illumina [3-4] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
involved_in | GO:0010455 positive regulation of cell fate commitment |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:22539765 | results_in_commitment_to CL:0000746 |
involved_in | GO:0010831 positive regulation of myotube differentiation |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:24804980 | |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:24804980 | has_input UniProtKB:P21237 |