Mature hsa-miR-197-3p
| Accession | MIMAT0000227 |
| Description | hsa-miR-197-3p mature miRNA |
| Hairpins | |
| Sequence | UUCACCACCUUCUCCACCCAGC |
| Evidence |
experimental
cloned [1-3] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| acts_upstream_of | GO:0032701 negative regulation of interleukin-18 production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23710316 | occurs_in CL:0000576 |
| involved_in | GO:0032701 negative regulation of interleukin-18 production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23710316 | |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23710316 | has_input UniProtKB:Q14116 |
| involved_in | GO:1900015 regulation of cytokine production involved in inflammatory response |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23710316 | occurs_in CL:0000576 |
| located_in | GO:0005615 extracellular space |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26646931 | part_of UBERON:0001969 |
| located_in | GO:0070062 extracellular exosome |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31926946 | produced_by CL:0000235 |
StarBase
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
| Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
|---|
miR2Disease
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
| Disease | Differential expression | Experiment | Year | Study |
|---|
