Mature mmu-miR-126a-3p
| Accession | MIMAT0000138 |
| Description | mmu-miR-126a-3p mature miRNA |
| Hairpins | |
| Sequence | UCGUACCGUGAGUAAUAAUGCG |
| Evidence |
experimental
cloned [1,3-4], Illumina [5-6] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:18694565 | has_input UniProtKB:Q924S8 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26934179 | has_input UniProtKB:P53351 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26934179 | has_input UniProtKB:Q543V3 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26934179 | has_input UniProtKB:Q924S8 |
| involved_in | GO:0001954 positive regulation of cell-matrix adhesion |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26934179 | has_input UniProtKB:P09055 |
| involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26646931 | has_input UniProtKB:Q9CPV9 |
| involved_in | GO:0030335 positive regulation of cell migration |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26934179 | |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:18694565 | has_input UniProtKB:Q924S8 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24749062 | has_input UniProtKB:Q543V3 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26934179 | has_input UniProtKB:P53351 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26934179 | has_input UniProtKB:Q543V3 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26934179 | has_input UniProtKB:Q924S8 |
| involved_in | GO:0045766 positive regulation of angiogenesis |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26934179 | |
| involved_in | GO:0070374 positive regulation of ERK1 and ERK2 cascade |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:18694565 | |
| involved_in | GO:0070374 positive regulation of ERK1 and ERK2 cascade |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26934179 | |
| involved_in | GO:0090050 positive regulation of cell migration involved in sprouting angiogenesis |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:18694565 | |
| involved_in | GO:1901731 positive regulation of platelet aggregation |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26646931 | occurs_in UBERON:0001969 |
| involved_in | GO:1903589 positive regulation of blood vessel endothelial cell proliferation involved in sprouting angiogenesis |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:18694565 | |
| involved_in | GO:1904018 positive regulation of vasculature development |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:18694565 | occurs_in UBERON:0000948 |
