Mature sequence dme-miR-14-3p

• Accession number: MIMAT0000120
• ID: dme-miR-14-3p
• Previous IDs: dme-miR-14
• Stem-Loop: dme-mir-14
• Sequence: ucagucuuuuucucucuccuau
• Deep sequencing: 1562350 reads, 49 experiments
• Database links:
  • RNAcentral:URS00003DE3EC_7227
• Predicted targets:
  • TargetScanFly:dme-miR-14
  • microrna.org:dme-miR-14-3p

References

1. PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2. PMID:12725740 "The Drosophila microRNA Mir-14 suppresses cell death and is required for normal fat metabolism" Xu P, Vernooy SY, Guo M, Hay BA Curr Biol. 13:790-795(2003).
3. PMID:12812784 "Temporal regulation of microRNA expression in Drosophila melanogaster mediated by hormonal signals and broad-Complex gene activity" Sempere LF, Sokol NS, Dubrovsky EB, Berger EM, Ambros V Dev Biol. 259:9-18(2003).
4. PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
5. PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
6. PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).