Mature hsa-miR-105-5p
| Accession | MIMAT0000102 |
| Description | hsa-miR-105-5p mature miRNA |
| Hairpins | |
| Sequence | UCAAAUGCUCAGACUCCUGUGGU |
| Evidence |
experimental
cloned [1-2] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| acts_upstream_of | GO:0002862 negative regulation of inflammatory response to antigenic stimulus |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:19509287 | occurs_in CL:0002621 |
| acts_upstream_of | GO:0032715 negative regulation of interleukin-6 production |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:19509287 | occurs_in CL:0002621 |
| acts_upstream_of | GO:0032720 negative regulation of tumor necrosis factor production |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:19509287 | occurs_in CL:0002621 |
| acts_upstream_of | GO:1903347 negative regulation of bicellular tight junction assembly |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24735924 | has_input UniProtKB:Q07157 |
| enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24735924 | |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:19509287 | has_input UniProtKB:O60603 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23874542 | has_input UniProtKB:P50539 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24735924 | has_input UniProtKB:Q07157 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27185878 | has_input UniProtKB:P01160 |
| involved_in | GO:0009617 response to bacterium |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:19509287 | occurs_in CL:0002621 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:19509287 | has_input UniProtKB:O60603 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23874542 | has_input UniProtKB:P50539 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24735924 | has_input UniProtKB:Q07157 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27185878 | has_input UniProtKB:P01160 |
| involved_in | GO:0071726 cellular response to diacyl bacterial lipopeptide |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:19509287 | occurs_in CL:0002621 |
StarBase
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
| Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
|---|
miR2Disease
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
| Disease | Differential expression | Experiment | Year | Study |
|---|
