Mature sequence hsa-miR-29a-3p

Accession numberMIMAT0000086
IDhsa-miR-29a-3p
Previous IDshsa-miR-29a
Stem-Loop hsa-mir-29a
Sequence 
uagcaccaucugaaaucgguua
Get sequence
Deep sequencing4820720 reads, 159 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
3
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
4
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
5
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
6
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
7
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
8
PMID:20158877 "Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha" Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V BMC Genomics. 11 Suppl 1:S6(2010).