Mature sequence hsa-miR-25-3p

• Accession number: MIMAT0000081
• ID: hsa-miR-25-3p
• Previous IDs: hsa-miR-25
• Stem-Loop: hsa-mir-25
• Sequence: cauugcacuugucucggucuga
• Deep sequencing: 1210086 reads, 159 experiments
• Database links:
  • RNAcentral:URS00004F9744_9606
• Predicted targets:
  • TargetMiner:hsa-miR-25-3p
  • TargetScanVert:hsa-miR-25-3p
  • miRDB:hsa-miR-25-3p
  • microrna.org:hsa-miR-25-3p

References

1. PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2. PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).