Accession | MIMAT0000072 |
Description | hsa-miR-18a-5p mature miRNA |
Hairpins | |
Sequence | UAAGGUGCAUCUAGUGCAGAUAG |
Evidence |
experimental
cloned [1,3-6], Northern [1] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:20940405 | has_input UniProtKB:Q13485 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21067317 | has_input UniProtKB:Q8NFP9 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21145484 | has_input UniProtKB:Q13485 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21145484 | has_input UniProtKB:Q15796 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24169826 | has_input UniProtKB:P31994 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28131417 | has_input UniProtKB:P37173 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29988076 | has_input UniProtKB:P36956 |
involved_in | GO:0010719 negative regulation of epithelial to mesenchymal transition |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:28131417 | occurs_in CL:1000491 |
involved_in | GO:0030512 negative regulation of transforming growth factor beta receptor signaling pathway |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21145484 | |
involved_in | GO:0030512 negative regulation of transforming growth factor beta receptor signaling pathway |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:28131417 | has_input UniProtKB:P37173 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:20940405 | has_input UniProtKB:Q13485 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21067317 | has_input UniProtKB:Q8NFP9 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21145484 | has_input UniProtKB:Q13485 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21145484 | has_input UniProtKB:Q15796 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24169826 | has_input UniProtKB:P31994 |
involved_in | GO:0035279 miRNA-mediated gene silencing by mRNA destabilization |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28131417 | has_input UniProtKB:P37173 |
involved_in | GO:0035279 miRNA-mediated gene silencing by mRNA destabilization |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29988076 | has_input UniProtKB:P36956 |
involved_in | GO:0050861 positive regulation of B cell receptor signaling pathway |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24169826 | |
involved_in | GO:1901202 negative regulation of extracellular matrix assembly |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:28131417 | |
involved_in | GO:1903671 negative regulation of sprouting angiogenesis |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:20299512 | |
involved_in | GO:1903845 negative regulation of cellular response to transforming growth factor beta stimulus |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:28131417 | has_input UniProtKB:P01137 |
involved_in | GO:1905932 positive regulation of vascular associated smooth muscle cell differentiation involved in phenotypic switching |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | occurs_in CL:0000359 |
located_in | GO:0005615 extracellular space |
ECO:0007005 high throughput direct assay evidence used in manual assertion |
PMID:18766170 | part_of UBERON:0001969 |
located_in | GO:0005615 extracellular space |
ECO:0007005 high throughput direct assay evidence used in manual assertion |
PMID:26646931 | part_of UBERON:0001969 |
located_in | GO:0048471 perinuclear region of cytoplasm |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | part_of CL:0000746 |
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
---|
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
Disease | Differential expression | Experiment | Year | Study |
---|