Mature sequence hsa-miR-15a-5p

• Accession number: MIMAT0000068
• ID: hsa-miR-15a-5p
• Previous IDs: hsa-miR-15a
• Stem-Loop: hsa-mir-15a
• Sequence: uagcagcacauaaugguuugug
• Deep sequencing: 1119618 reads, 160 experiments
• Database links:
  • RNAcentral:URS00003D1AE3_9606
• Predicted targets:
  • TargetMiner:hsa-miR-15a-5p
  • TargetScanVert:hsa-miR-15a-5p
  • miRDB:hsa-miR-15a-5p
  • microrna.org:hsa-miR-15a-5p

References

1. PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2. PMID:12434020 "Frequent deletions and down-regulation of micro- RNA genes miR15 and miR16 at 13q14 in chronic lymphocytic leukemia" Calin GA, Dumitru CD, Shimizu M, Bichi R, Zupo S, Noch E, Aldler H, Rattan S, Keating M, Rai K, Rassenti L, Kipps T, Negrini M, Bullrich F, Croce CM Proc Natl Acad Sci U S A. 99:15524-15529(2002).
3. PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4. PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
5. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).