MIR532 is a microRNA that has been found to be significantly up-regulated in a high percentage of hepatocellular carcinoma (HCC) patients who are positive for hepatitis C virus (HCV) [PMC3245605]. No single nucleotide polymorphisms (SNPs) have been identified for MIR532 [PMC6195525]. MIR532 has been used as a normalizer in miRNA expression studies [PMC7266158]. Interestingly, MIR532 has been shown to inhibit the invasiveness of tumor cells, while miR500A, which is located upstream of MIR532, increases tumor invasion [PMC8253104]. MIR532 acts as a tumor suppressor by inhibiting the expression of TERT in ovarian cancer, leading to decreased cell proliferation and lower invasion capacity [PMC8253104]. TERT directly interacts with the upstream region of miR500A but fails to bind the upstream sequence of MIR532, which also contains TBE sequences [PMC8253104]. In ovarian cancer patients, high expression levels of MIR502 and MIR532 have been correlated with overall survival outcome [PMC7359466]. Exosomal MIR532 has also shown prognostic value and is associated with favorable overall survival in acute myeloid leukemia patients [PMC7912829]. The regulation characteristics between the promoters of CLCN5 and MIR532 are distinct, with TTF-1 playing a role in activating the MIR532 promoter but not the CLCN5 promoter [PMC5497805].
cgacuu u c c U A A CC uggca gcuu cucu cu CA GCCUUG GUGU GGA GU u |||| |||| || || |||||| |||| ||| || c cgag gaga gA GU CGGAAC CACA CCU ca u ----uc c a C U C C CC uuaau
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0002888 |
Description | Homo sapiens hsa-miR-532-5p mature miRNA |
Sequence | 20 - CAUGCCUUGAGUGUAGGACCGU - 41 |
Evidence |
experimental
PCR [1], cloned [2-3] |
Database links | |
Predicted targets |
Accession | MIMAT0004780 |
Description | Homo sapiens hsa-miR-532-3p mature miRNA |
Sequence | 57 - CCUCCCACACCCAAGGCUUGCA - 78 |
Evidence |
experimental
cloned [2] |
Database links | |
Predicted targets |
|