MIRLET7G is a microRNA that has been reported to have increased expression in canine and human mammary tumor cell lines [PMC9210832]. It is located at 3p21.1 and is one of the most common genes found in tumor samples [PMC5423597]. MIRLET7G has been identified as one of the top 40 differential genes in a study on pediatric cancers [PMC9730279]. It has also been found to interact with NANOG and POUSF1, suggesting its involvement in adipogenesis and osteogenesis differentiation processes [PMC4951121]. MIRLET7G, along with other microRNAs such as MIR302A, MIR21, and MR137, was selected for validation using qPCR [PMC4951121]. In addition to its role in cancer, MIRLET7G has also been implicated in retinal oxygenation and autophagy regulation [PMC8319207] [PMC6333457]. The reduced expression of MIRLET7G has been associated with the beneficial effects of retinal oxygenation in response to AFL treatment [PMC8319207]. Furthermore, E2 was found to suppress the expression of MIRLET7G in a time- and MAP2K/MEK-MAPK-dependent manner in MCF-7 cells [PMC6333457]. Overall, these findings highlight the importance of MIRLET7G as a potential biomarker and therapeutic target for various diseases.
a U A ugagg -a a a ggc GAGGUAGU GUUUGUACAGUU gucu ug uacc c ||| |||||||| |||||||||||| |||| || |||| cCG UUCCGUCA CGGACAUGUCaa uaga ac augg c a - C ----- gg - c
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000414 |
Description | Homo sapiens hsa-let-7g-5p mature miRNA |
Sequence | 5 - UGAGGUAGUAGUUUGUACAGUU - 26 |
Evidence |
experimental
cloned [2-3], Illumina [4] |
Database links | |
Predicted targets |
Accession | MIMAT0004584 |
Description | Homo sapiens hsa-let-7g-3p mature miRNA |
Sequence | 62 - CUGUACAGGCCACUGCCUUGC - 82 |
Evidence |
experimental
cloned [2] |
Database links | |
Predicted targets |
|