MIR4454 is a microRNA that has been found to be overexpressed in ameloblastomas, a type of tumor, in several studies [PMC7920560] [PMC5354851]. Artificial induction of MIR4454 expression has been shown to reduce tumor tissue and increase sensitivity to certain drugs, such as 5FU, CPT11, and oxaliplatin [PMC7602903]. The drug transporter MRP5 has been found to decrease sensitivity to oxaliplatin by increasing drug efflux and reducing intracellular oxaliplatin accumulation [PMC7602903]. Downregulation of MIR4454 has been associated with drug resistance in colorectal cancer [PMC7602903]. Additionally, it has been observed that some reads of hsa-miR-4454 display heterogenous 5' ends that differ from the annotated genomic locus sequence but match the sequence of tRNAHis [PMC6675128]. The expression profile of three miRNAs related to hepatocellular carcinoma (HCC), including MIR4454, was assessed using RT-qPCR at different time points in order to determine the effect of different combinations of reference genes on normalization [PMC7035418]. Overall, these studies highlight the potential role and significance of MIR4454 in tumor development and drug response.
--cc A - GAGU - - aa GG UC C CACGG CAC CA u || || | ||||| ||| || u cc ag g gugcc gug gu u acca - a aagu u c ac
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0018976 |
Description | Homo sapiens hsa-miR-4454 mature miRNA |
Sequence | 3 - GGAUCCGAGUCACGGCACCA - 22 |
Evidence |
experimental
Illumina [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|