MIR208B is a microRNA that is encoded within the intron of the MYH7 gene, which codes for the slow isoform of Myosin Heavy Chain (MyHC). It has been shown to play a role in regulating mitochondrial function and metabolism in cooperation with KLF4, ESRR, and PGC-1 [PMC5586433]. MIR208B is differentially expressed in a sex- and hypertrophy-dependent manner, with an increase reported in hypertrophy [PMC5586433]. It is generated from an intron of Myh7, which is the cardiac fetal isoform that switches to Myh6 after birth [PMC5586433]. MIR208B has been implicated in the regulation of skeletal muscle fiber type switch to Myh7 through its interaction with PPARĪ± and ESRRG [PMC7123062]. It has also been associated with cardiac hypertrophy and its downregulation has been observed in patients with amyotrophic lateral sclerosis (ALS) [PMC5573384] [PMC8424364]. MIR208B has been shown to target genes such as Sox6, Sp3, Thrap1, EZH2, EED, and SUZ12 [PMC4488424] [PMC4754821]. Additionally, changes in MIR208B expression have been observed during muscle atrophy and cancer cachexia [PMC8260947] [PMC8396502]. The role of MIR208B in regulating muscle regeneration and differentiation can be influenced by essential amino acid intake [PMC8466275]. Plasma levels of MIR208B have also been found to be elevated by cardiovascular damage [PMC3157373]
--c g C AA cu cucucagg AAGCUUUUUG UCG UUAUGUuu g |||||||| |||||||||| ||| |||||||| a gggagucU UUUGGAAAAC AGC AAUAuaag u gac G A AG cc
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004960 |
Description | Homo sapiens hsa-miR-208b-3p mature miRNA |
Sequence | 46 - AUAAGACGAACAAAAGGUUUGU - 67 |
Evidence |
experimental
cloned [2], Illumina [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
Accession | MIMAT0026722 |
Description | Homo sapiens hsa-miR-208b-5p mature miRNA |
Sequence | 11 - AAGCUUUUUGCUCGAAUUAUGU - 32 |
Evidence |
experimental
Illumina [3] |
|