MIR542 is a microRNA that has been found to harbor missense mutations in its stem-loop coding region, along with other microRNAs such as MIR662 and MIR663 [PMC4017260]. In glioblastoma multiforme (GBM), MIR542 has been shown to target the AEG-1 gene, potentially suppressing the epithelial-mesenchymal transition (EMT) process in U251 cells [PMC7575175]. The functional mechanism of MIR542 was investigated by screening its targeted genes using online tools, and AEG-1 was identified as a target [PMC7575175]. The down-regulation of AEG-1 by MIR542 was found to suppress the EMT process and inhibit the migration and proliferation of U251 cells [PMC7575175]. Luciferase reporter assays confirmed that a specific region in the 3'-UTR of AEG-1 gene was targeted by MIR542 [PMC7575175'>PMC7575175'>PMC7575175'>PMC7575175]. In vitro experiments showed that transfection with MIR542 reduced the migration abilities of U251 cells compared to other microRNAs [PMC7575175]. Furthermore, it was observed that MIR542 inhibited EMT through down-regulating AEG-1 at both mRNA and protein levels in U251 cells [PMC7575175]. These findings suggest that MIR542 may act as a tumor suppressor in human malignancies, including glioma, by regulating AEG-1 expression and suppressing EMT process [PMC7575175]. References: [PMC4017260] - Liang H., et al. (2013) miR-662 is involved in cervical carcinogenesis through regulating both proliferation and invasion abilities of human cervical cells. Gynecol Oncol. 2013 Dec;131(3):651-7. [PMC7575175] - Liang H., et al. (2020) MIR542-3p inhibits the migration and proliferation of glioma cells by targeting AEG-1 and suppressing EMT. Onco Targets Ther. 2020 Sep 3;13:8851-8862.
----------caga auc GG UCA -A c ucucagac UCGG AUCA UGUCACGAG uac a |||||||| |||| |||| ||||||||| ||| agggucug AGUC UAGU ACAGUGUuc gug g acuucuacucaccg gAA AA UAG ac u
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0003340 |
Description | Homo sapiens hsa-miR-542-5p mature miRNA |
Sequence | 16 - UCGGGGAUCAUCAUGUCACGAGA - 38 |
Evidence |
experimental
cloned [1-3] |
Database links | |
Predicted targets |
Accession | MIMAT0003389 |
Description | Homo sapiens hsa-miR-542-3p mature miRNA |
Sequence | 53 - UGUGACAGAUUGAUAACUGAAA - 74 |
Evidence |
experimental
cloned [1-2] |
Database links | |
Predicted targets |
|