MIR652 is a microRNA that has been studied in various contexts. In the EOMG subgroup, MIR652 was found to be in low levels, along with other miRNAs such as miR518d, let7g, miR-192, miR24, miR15b, let7e, miR221, miR-345, miR20b, miR-140 and miR331 [PMC3956820]. In both KO and KI mice models, MIR652 was upregulated and negatively regulated spermatid differentiation [PMC10001410]. In breast cancer cases versus controls, MIR652 was found to be downregulated in serum samples [PMC9967215]. Furthermore, MIR652 was identified as a potential biomarker for breast cancer in multiple independent clinical studies [PMC9967215]. Additionally, the expression of MIR652 has been analyzed in relation to tumor relapse and overall survival in patients with triple-negative breast cancer (TNBC) [PMC7392022]. A four-miRNA signature consisting of MIR18b (miRNA-18b), MIR103 (miRNA-103), MIR107 (miRNA-107), and MIR652 was found to be predictive of tumor relapse and overall survival in TNBC patients [PMC7392022]. Overall, these studies highlight the potential role of MIR652 as a biomarker for various diseases and its involvement in spermatid differentiation.
acgaau cua GAGAG ca g gg ugcacugcaCAACCCUAG GGUGCCAUUCA ua a || |||||||||||||||||| ||||||||||| || c cc acgugacGUGUUGGGAUC CCGCGGUAAgu au u -cacau aac ----A ua a
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0003322 |
Description | Homo sapiens hsa-miR-652-3p mature miRNA |
Sequence | 61 - AAUGGCGCCACUAGGGUUGUG - 81 |
Evidence |
experimental
Microarray [1], SAGE [1], cloned [2] |
Database links | |
Predicted targets |
Accession | MIMAT0022709 |
Description | Homo sapiens hsa-miR-652-5p mature miRNA |
Sequence | 21 - CAACCCUAGGAGAGGGUGCCAUUCA - 45 |
Evidence | not_experimental |
Database links | |
Predicted targets |
|