MIR487B is a microRNA that belongs to the miR655 miRNA cluster and is expressed in various tissues and diseases. It is one of the miRNAs in the cluster that has available expression data [PMC7465874]. MIR487B has been found to be downregulated in gliomas, but its functional role in glial neoplasms has not been explored [PMC5288128]. In an in vivo model of chronic heart failure, MIR487B was found to inhibit the IL-33/ST2 signaling axis, resulting in improved cardiac morphology and reduced collagen expression [PMC8663982]. MIR487B is also part of the DLK1-MEG3 cluster and has been shown to be significantly reduced or silenced by DNA hypermethylation in bladder tumor tissues and cell lines [PMC4348104]. In multiple sclerosis, MIR487B is less expressed in the diseased context [PMC4655260]. Tobacco smoking-induced epigenetic downregulation of MIR487B leads to overexpression of various polycomb group proteins and stem cell-related genes [PMC6116004]. Chromosome 8 contains an expression quantitative trait locus (eQTL) for MIR487B [PMC4755013]. Additionally, elevated levels of MIR487B have been observed in peripheral blood mononuclear cells of patients with stroke [PMC7123062]. Higher expression levels of MIR487B have also been associated with poor survival outcomes based on data from The Cancer Genome Atlas (TCGA) database [PMC5975595]. A-to-I editing and Nm modifications can alter the targets of tumor suppressor microRNA such as MIR487B, promoting angiogenesis. Increased levels of Ψ writers RPUSD3 and RPUSD4 can induce defective assembly of oxidative phosphorylation system proteins [PMC9916637].
u u UUAU C U uuuug ugguacu ggagaGUGG CCCUGU C GUUCG c ||||||| ||||||||| |||||| | ||||| acuauga uuuUUCACC GGGACA G UAAgc u a c UACU U C uguac
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0003180 |
Description | Homo sapiens hsa-miR-487b-3p mature miRNA |
Sequence | 51 - AAUCGUACAGGGUCAUCCACUU - 72 |
Evidence |
experimental
cloned [1-2], Illumina [3] |
Database links | |
Predicted targets |
Accession | MIMAT0026614 |
Description | Homo sapiens hsa-miR-487b-5p mature miRNA |
Sequence | 15 - GUGGUUAUCCCUGUCCUGUUCG - 36 |
Evidence |
experimental
Illumina [3] |
|