MIR362 is a miRNA that is part of a cluster of eight miRNAs located in the intron 3 of the CLCN5 gene on the short arm of the X chromosome [PMC8253104]. It is regulated by TERT and is downstream of miR500A [PMC8253104]. MiR500A and all miRNAs downstream of the cluster are known to act as oncomiRs and are associated with various cancer types, including hepatocellular carcinoma, gastric cancer, and breast cancer [PMC8253104]. In gastric cancer tissues, upregulation of MIR362 has been shown to promote cell proliferation and resistance to apoptosis [PMC4241533]. Higher levels of MIR362 expression have been observed in H1299 and 95-D cell lines compared to H460 and A549 cell lines [PMC6093061]. MIR362 has also been identified as a potential regulator of target mRNAs along with miR21, miR34a, and miR203 [PMC9097102]. The expression profile and secretion pattern of MIR362 may play a role in the complex development and endocrine function of adipose tissue [PMC4892883]. The processing and maturation of MIR362 requires the RNA-processing enzyme Dicer, which has been found to decline over time in various organisms including mice with adipose-specific deficiency in Dicer showing effects on white adipose tissue development when challenged by a high-fat diet [PMC9097102] [PMC4892883]
c ACC -A a uugAAUCCUUGGA UAGGUGUG GUgcu u ||||||||||||| |||||||| ||||| u aACUUAGGAACUU AUCCACAC cguga u a --- AA c
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000705 |
Description | Homo sapiens hsa-miR-362-5p mature miRNA |
Sequence | 5 - AAUCCUUGGAACCUAGGUGUGAGU - 28 |
Evidence |
experimental
array-cloned [1], cloned [2-3] |
Database links | |
Predicted targets |
Accession | MIMAT0004683 |
Description | Homo sapiens hsa-miR-362-3p mature miRNA |
Sequence | 42 - AACACACCUAUUCAAGGAUUCA - 63 |
Evidence |
experimental
cloned [3] |
Database links | |
Predicted targets |
|