sort by

12 publications mentioning ssc-mir-26b

Open access articles that are associated with the species Sus scrofa and mention the gene name mir-26b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 20
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-22, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-98, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-101a, mmu-mir-126a, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-142a, mmu-mir-181a-2, mmu-mir-194-1, hsa-mir-208a, hsa-mir-30c-2, mmu-mir-122, mmu-mir-143, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-208a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29c, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-20a, rno-mir-101b, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-17, mmu-mir-19a, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-19b-1, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19a, rno-mir-22, rno-mir-26a, rno-mir-26b, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30c-2, rno-mir-98, rno-mir-101a, rno-mir-122, rno-mir-126a, rno-mir-130a, rno-mir-133a, rno-mir-142, rno-mir-143, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-194-1, rno-mir-194-2, rno-mir-208a, rno-mir-181a-1, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, ssc-mir-122, ssc-mir-15b, ssc-mir-181b-2, ssc-mir-19a, ssc-mir-20a, ssc-mir-26a, ssc-mir-326, ssc-mir-181c, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-18a, ssc-mir-29c, ssc-mir-30c-2, hsa-mir-484, hsa-mir-181d, hsa-mir-499a, rno-mir-1, rno-mir-133b, mmu-mir-484, mmu-mir-20b, rno-mir-20b, rno-mir-378a, rno-mir-499, hsa-mir-378d-2, mmu-mir-423, mmu-mir-499, mmu-mir-181d, mmu-mir-18b, mmu-mir-208b, hsa-mir-208b, rno-mir-17-2, rno-mir-181d, rno-mir-423, rno-mir-484, mmu-mir-1b, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, ssc-mir-17, ssc-mir-130a, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-1, ssc-mir-181a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-499, ssc-mir-143, ssc-mir-423, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-98, ssc-mir-208b, ssc-mir-142, ssc-mir-19b-1, hsa-mir-378b, ssc-mir-22, rno-mir-126b, rno-mir-208b, rno-mir-133c, hsa-mir-378c, ssc-mir-194b, ssc-mir-133a-2, ssc-mir-484, ssc-mir-30c-1, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, mmu-mir-101c, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-18b, hsa-mir-378j, rno-mir-378b, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-mir-451b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-194a, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, rno-let-7g, rno-mir-15a, ssc-mir-378b, rno-mir-29c-2, rno-mir-1b
Thus, miRNA families (e. g., miR-1 and miR-122) that are specifically or highly expressed in any one of the 3 tissues, or miRNAs that are expressed ubiquitously (e. g., let-7 and miR-26) in all 3 tissues, show a far greater frequency than other miRNAs. [score:5]
The observation that miR-22, miR-26b, miR-126, miR-29c and miR-30c are ubiquitously expressed in 14 different tissues of pig is interesting. [score:3]
Additionally, many other miRNAs, such as let-7, miR-98, miR-16, miR22, miR-26b, miR-29c, miR-30c and miR126, were also expressed abundantly in thymus (Figure 3). [score:3]
miR-22, miR-26b, miR-29c, miR-30c and miR-126 exhibited almost similar expression patterns in all tissues examined (Figure 3B). [score:3]
For instance, let-7 is represented by 445 reads and miR-26 by 177 reads (Tables 1 and 2), and these two miRNAs are ubiquitously expressed in the heart, liver and thymus (Figure 3A and 3B). [score:3]
miR-22, miR-26b, miR-29c and miR-30c showed ubiquitous expression in diverse tissues. [score:3]
[1 to 20 of 6 sentences]
2
[+] score: 9
Only 27 miRNAs followed the same expression profile in both approaches, and 11 of them where DE in both groups: 4 miRNAs (miR-26b-5p, miR-29b-2-5p, miR-450b-5p and miR-450c-5p) were only expressed in infected groups and the remaining 7 miRNAs (let-7b-3p, miR-193b, miR-345-5p, miR-1306-5p, miR-2779, miR-2898 and miR-4286) were more expressed in mock-infected or healthy group, although all of them were expressed at low levels (CN<100) in both profiles. [score:9]
[1 to 20 of 1 sentences]
3
[+] score: 7
LD group was associated with lipid metabolism and organ morphology; the NAAA gene is central to this network, hypermethylated and down-regulated in LD pigs compared with TC pigs, and negatively regulated by miR-26. [score:4]
NAAA plays a key role in the degradation of N-acylethanolamines, which are ethanolamides of long-chain fatty acids 81. miR-26 expression has been reported to promote energy dissipation and differentiation of myoblasts 82 83. [score:3]
[1 to 20 of 2 sentences]
4
[+] score: 7
Further, miR-26a1/2 and miR-26b down-regulate BDNF (brain-derived neurotrophic factor) expression, which is a neurotrophin that plays an essential role in neuronal development and plasticity 23. [score:7]
[1 to 20 of 1 sentences]
5
[+] score: 7
In another important human disease, diabetes, the study by Melkman et al. [5] into the effects of miRNAs on insulin synthesis revealed that knocking out miR-24, miR-26, miR-182, or miR-148 reduced the transcriptional activity of the insulin gene promoter, thereby reducing the level of insulin mRNA. [score:4]
miR-22, miR-26b, miR-29c, and miR-30c were wi dely expressed in various tissues. [score:3]
[1 to 20 of 2 sentences]
6
[+] score: 5
Other miRNAs from this paper: ssc-mir-26a, ssc-mir-27a, ssc-mir-1, ssc-mir-29a, ssc-mir-27b
Expression rates were corrected for PCR efficiencies using dilution curves and the expressions of the candidate reference genes (let7a, miR-26, miR-27, RNU6B) were entered in Normfinder [13] for identification of the most stable transcripts. [score:5]
[1 to 20 of 1 sentences]
7
[+] score: 5
Gene targeted by the disease miRNA26. [score:5]
[1 to 20 of 1 sentences]
8
[+] score: 5
miRNA Name Sequence (5'–3') Regulation p-Value ssc-miR-21 TAGCTTATCAGACTGATGTTGA Up 0 ssc-miR-148b-3p UCAGUGCAUCAGAACUUUGU Up 0 ssc-miR-92a TATTGCACTTGTCCCGGCCTGT Up3.4 × 10 [−135] ssc-miR-423-3p AGCUCGGCUGAGGCCCCUCAGU Up1.1 × 10 [−154] ssc-miR-26 TTCAAGTAATCCAGGATAGGCT Down4 × 10 [−155] ssc-miR-24-3p UGGCUCAGUUCAGCAGGAACAG Down1.37 × 10 [−81] ssc-miR-181a AACAUUCAACGCUGUCGGUGAGUU Down1.67 × 10 [−61] ssc-miR-151-5p UCGAGGAGCUCAGUCUAGU Down6.9 × 10 [−4] Target gene prediction was performed to further understand the physiological functions and biological processes involving these miRNAs during mammary gland development and lactation, (Figure 7) based on miRNA/mRNA interactions to provide some molecular insight into the processes. [score:5]
[1 to 20 of 1 sentences]
9
[+] score: 5
Evidence of the importance of pituitary miRNAs involved in GH regulation is increasing; for example, miR-26b regulated GH by targeting LEF-1, a repressor of POU1F1[11]. [score:5]
[1 to 20 of 1 sentences]
10
[+] score: 4
Moreover, several hypoxia-regulated miRNAs play roles in cell survival in hypoxic environments and have been implicated in the regulation of both upstream and downstream HIF signaling pathways, e. g., miR-20b and miR-17-92 clusters, while miR-199a regulates HIF-1α under hypoxic conditions [8– 10], and miR-107, miR-210, miR-373, miR-23, miR-24, and miR-26 are induced by HIFs [7, 11, 12]. [score:4]
[1 to 20 of 1 sentences]
11
[+] score: 3
Thus far, only a few studies have addressed the involvement of miRNAs in the functions of the pituitary; miR-26 has recently been reported to be critical for anterior pituitary development [28], and most others are related to the development of tumors. [score:3]
[1 to 20 of 1 sentences]
12
[+] score: 2
Other miRNAs from this paper: ssc-mir-122, ssc-mir-125b-2, ssc-mir-181b-2, ssc-mir-20a, ssc-mir-23a, ssc-mir-26a, ssc-mir-29b-1, ssc-mir-181c, ssc-mir-214, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-21, ssc-mir-29c, ssc-mir-30c-2, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-20a, bta-mir-21, bta-mir-26b, bta-mir-30d, bta-mir-499, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-199a-1, bta-mir-30b, bta-mir-107, bta-mir-10a, bta-mir-127, bta-mir-142, bta-mir-181b-2, bta-mir-30e, bta-mir-92a-2, bta-let-7d, bta-mir-132, bta-mir-138-2, bta-mir-17, bta-mir-181c, bta-mir-192, bta-mir-199b, bta-mir-200a, bta-mir-200c, bta-mir-214, bta-mir-23a, bta-mir-29b-2, bta-mir-29c, bta-mir-455, bta-let-7g, bta-mir-10b, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-mir-30c, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-99b, ssc-mir-99b, ssc-mir-17, ssc-mir-30b, ssc-mir-199b, bta-mir-1-2, bta-mir-1-1, bta-mir-129-1, bta-mir-129-2, bta-mir-133a-2, bta-mir-133a-1, bta-mir-133b, bta-mir-135b, bta-mir-138-1, bta-mir-143, bta-mir-144, bta-mir-146b, bta-mir-146a, bta-mir-181d, bta-mir-190a, bta-mir-199a-2, bta-mir-202, bta-mir-206, bta-mir-211, bta-mir-212, bta-mir-223, bta-mir-26a-1, bta-mir-29d, bta-mir-30f, bta-mir-338, bta-mir-33a, bta-mir-33b, bta-mir-375, bta-mir-429, bta-mir-451, bta-mir-92a-1, bta-mir-92b, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, ssc-mir-133a-1, ssc-mir-1, ssc-mir-146b, ssc-mir-181a-1, ssc-mir-30a, bta-mir-199c, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-133b, ssc-mir-29a, ssc-mir-30d, ssc-mir-30e, ssc-mir-199a-2, ssc-mir-499, ssc-mir-143, ssc-mir-10a, ssc-mir-10b, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-99a, ssc-mir-92a-2, ssc-mir-92a-1, ssc-mir-92b, ssc-mir-192, ssc-mir-142, ssc-mir-127, ssc-mir-202, ssc-mir-129a, ssc-mir-455, ssc-mir-125b-1, ssc-mir-338, ssc-mir-133a-2, ssc-mir-146a, bta-mir-26c, ssc-mir-30c-1, ssc-mir-126, ssc-mir-199a-1, ssc-mir-451, ssc-let-7a-2, ssc-mir-129b, ssc-mir-429, ssc-let-7d, ssc-let-7f-2, ssc-mir-29b-2, ssc-mir-132, ssc-mir-138, ssc-mir-144, ssc-mir-190a, ssc-mir-212, bta-mir-133c, ssc-mir-200b, ssc-mir-223, ssc-mir-375, ssc-mir-33b
Ramachandra et al. (2008) discovered 14 miRNAs in early embryos (5 dpf); among these, miR-21, miR-30d, miR-92a, miR-200, and miR-26 are associated with differentiation and development. [score:2]
[1 to 20 of 1 sentences]