sort by

5 publications mentioning chi-mir-222

Open access articles that are associated with the species Capra hircus and mention the gene name mir-222. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 41
Interestingly, ESR1 was down-regulated by food deprivation and potentially targeted by miR-125b-3p, miR-222-3p, and chr19_26739-5p, and up-regulated in the mammary gland of FD goats. [score:9]
These observations suggest that the up-regulation of miR-222-3p by food deprivation may be responsible for the down-regulation of ESR1. [score:7]
In addition, seven known (miR-99a-3p, miR-188-5p, miR-196a-5p, miR-204-5p, miR-222-3p, miR-223-3p and miR-494-3p) and six predicted miRNA (chr3_4386-3p, chr3_4386-5p, chr12_17655-3p, chr19_26739-5p, chr23_30758-5p and chr27_34538-5p) were expressed at moderate levels with normalized read counts of between 100 and 1,000, and three known (miR-223-5p, miR-541-5p and miR-671-5p) and five predicted (chr3_3319-5p, chr4_6064-5p, chr9_13534-5p, chr12_18027-5p and chr23_30758-5p) were weakly expressed with normalized read counts below 100. [score:5]
Seven miRNA were chosen for RT-qPCR validation among known miRNA which expression was affected by the food deprivation and based on their level of expression; miR-99a-5p (TaqMan [®] ID 006254_mat, Applied Biosystems), miR-126-3p (TaqMan [®] ID 008451_mat), miR-140-3p (TaqMan [®] ID 471823_mat), miR-222-3p (TaqMan [®] ID 000525), miR-223-3p (TaqMan [®] ID 002295), miR-204-5p (TaqMan [®] ID 000508), miR-409-3p (TaqMan [®] ID 002332). [score:5]
In addition miR-222-3p has been confirmed as directly targeting ESR1 in breast cancer cell lines [68]. [score:4]
Finally, five nutriregulated miRNA: miR-222-3p, miR-188-5p, miR-541-5p, miR-494-3p and chr3_3319-5p, may target PTEN (Phosphatase and TENsin homologue) (Fig 4). [score:4]
Analyses were performed using DIANA microT v5.0 [36] for miR-125b-3p and miR-222-3p and Custom Target Scan v5.2 [37] for chr19_26739-5p. [score:3]
Interestingly, miR-222-3p, miR-409-3p, miR-541-5p, miR-6119-5p, miR-660-5p, chr23_30758-5p and chr3_4386-5p potentially target several genes coding for casein kinases 1 and 2 alpha and gamma (S4 Table). [score:3]
The interaction between 3’UTR of ESR1 and the seed region of miR-222-3p of one binding site is described in the box. [score:1]
[1 to 20 of 9 sentences]
2
[+] score: 12
confirmed the down-regulation of 8 miRNAs (novel-miR-51, novel-miR-99, miR-30d, miR-574, miR-222, miR-196a, miR-3613a, and miR-27a-5p) and the up-regulation of 4 miRNAs (novel-miR-75, miR-1246, miR-2478, and miR-2904) in infected MDBK cells compared with the uninfected (Figure 4A). [score:6]
Primer Sequence (5′-3′) bta-miR-30d TGTAAACATCCCCGACTGGAAGCT bta-miR-574 TGAGTGTGTGTGTGTGAGTGTGTG bta-miR-222 GAGCTACATCTGGCTACTGGGT bta-miR-196a GGCTAGGTAGTTTCATGTTGTTGGG bta-miR-3613a GCGGCTGTTGTACTTTTTTTTTTGTTC bta-miR-1246 GGCAATGGATTTTTGGAGCAGG bta-miR-2478 GCCGTATCCCACTTCTGACACCA bta-miR-2904 GGGAGCCTCGGTTGGCCT bta-miR-27a-5p GGCTTCACAGTGGCTAAGTTCCG novel-miR-51 TAATACTGCCTGGTAATGATGAC novel-miR-99 TTGGGAAGCACAGACACTAGGACT novel-miR-75 TCAAAGACTCGGACGTGACTGA 5S rRNA-F GTCTACGGCCATACCACCCT Table 2 Primers used to detect target genes expression with RT-qPCR. [score:3]
Primer Sequence (5′-3′) bta-miR-30d TGTAAACATCCCCGACTGGAAGCT bta-miR-574 TGAGTGTGTGTGTGTGAGTGTGTG bta-miR-222 GAGCTACATCTGGCTACTGGGT bta-miR-196a GGCTAGGTAGTTTCATGTTGTTGGG bta-miR-3613a GCGGCTGTTGTACTTTTTTTTTTGTTC bta-miR-1246 GGCAATGGATTTTTGGAGCAGG bta-miR-2478 GCCGTATCCCACTTCTGACACCA bta-miR-2904 GGGAGCCTCGGTTGGCCT bta-miR-27a-5p GGCTTCACAGTGGCTAAGTTCCG novel-miR-51 TAATACTGCCTGGTAATGATGAC novel-miR-99 TTGGGAAGCACAGACACTAGGACT novel-miR-75 TCAAAGACTCGGACGTGACTGA 5S rRNA-F GTCTACGGCCATACCACCCT Table 2 Primers used to detect target genes expression with RT-qPCR. [score:3]
[1 to 20 of 3 sentences]
3
[+] score: 6
Among the miRNAs that were up-regulated in the dry period mammary gland tissue, several were highly expressed in other tissues: miR-25, −221/222, and −93 in the heart and muscle; miR-222 in the liver; miR-93 in the heart and fat; and miR-128 in the lung and muscle. [score:6]
[1 to 20 of 1 sentences]
4
[+] score: 4
To verify the Solexa sequencing data, we randomly selected five differentially expressed miRNAs (miR-1, miR-206, miR-122, miR-222, and miR-133), and conducted quantitative RT-PCR. [score:3]
The abundance of miR-1, miR-206, miR-122, miR-222, and miR-133 were normalised relative to the abundance of U6 small nuclear RNA (snRNA). [score:1]
[1 to 20 of 2 sentences]
5
[+] score: 1
38– 40, theca cells (mir-24, miR-222 and miR-378) 40, 41, and oocytes (miR-10a, miR-10b, miR-100, let-7 family, etc. ) [score:1]
[1 to 20 of 1 sentences]