sort by

23 publications mentioning sly-MIR171e

Open access articles that are associated with the species Solanum lycopersicum and mention the gene name MIR171e. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 100
To study the role of this probable transcription factor, we generated transgenic tomato plants underexpressing Sl GRAS24, overexpressing Sl GRAS24, overexpressing Sly‐miR171 and expressing β‐glucuronidase (GUS) under the Sl GRAS24 promoter (proSl GRAS24‐ GUS). [score:9]
Tomato plants underexpressing SlGRAS24 did not differ from WT, while overexpression of Sly‐miR171 did cause plants to grow taller and flower earlier (Fig.   2A), providing another clue about the functional redundancy among GRAS family members or miR171 target genes. [score:7]
OE L10 and OE L15, two independent Sl GRAS24‐overexpressing lines; AS L3 and AS L5, two independent Sl GRAS24‐downexpressing lines; miR171 OE L4 and miR171 OE L15, two independent Sly‐miR171‐overexpressing lines. [score:7]
In tomato, six SlGRAS genes are clustered into the HAM subfamily, including SlGRAS24 and SlGRAS40, which are confirmed to be targeted for mRNA cleavage by miR171, and SlGRAS8, a suspected target gene whose translation is repressed by miR171 (Huang et al., 2015). [score:7]
The expression data here suggest that miR171‐SlGRAS24 regulatory networks are needed throughout vegetative and reproductive development in tomato. [score:5]
We tested this by generating transgenic plants overexpressing the precursor of tomato miR171 to silence miR171 target genes including SlGRAS24 (Table  1). [score:5]
miR171‐GRAS module controls flowering time (phase transition) and trichome distribution via inhibiting the activity of miR156‐targeted SPL proteins (Xue et al., 2014). [score:5]
Loss function of only one of the three miR171 target genes in Arabidopsis does not have visible effects on plant growth, while transgenic plants overexpressing MIR171c (35S‐109mmpro MIR171c) and scl6‐II scl6‐III scl6‐IV triple mutant plants exhibit a similar reduced shoot branching phenotype (Wang et al., 2010). [score:5]
Sly‐miR171 and SlGRAS24 are ubiquitously but differentially expressed in tomatoWe hypothesized that the SlGRAS24 gene and its regulator Sly‐miR171 would have similar functions in tomato as their respective orthologs in Arabidopsis (Wang et al., 2010). [score:4]
We previously identified a tomato (Solanum lycopersicum) GRAS transcription factor gene SlGRAS24 as target of tomato miR171 (Huang et al., 2015) and aimed to discover more about its function in tomato development here. [score:4]
Sly‐miR171 and SlGRAS24 are ubiquitously but differentially expressed in tomato. [score:3]
We previously identified tomato Sl GRAS24 as a target gene of Sly‐miR171. [score:3]
Further research showed that these miR171 target genes were not only required for shoot apical meristem maintenance, but for maintenance of root indeterminacy (Engstrom et al., 2011). [score:3]
Arabidopsis overexpressing miR171 and the triple scl6 mutants have similar pleiotropic phenotypes, where shoot branching, plant height, chlorophyll accumulation, primary root elongation, flower structure, and leaf shape and patterning were all altered (Wang et al., 2010). [score:3]
In Arabidopsis, Atham1, 2, 3 mutants occasionally produced flowers with three or five petals during the very early stages of flowering (Wang et al., 2010), which indicated the potential active roles of miR171‐targeted GRAS genes in flower organ formation. [score:3]
However, floral organs were an exception because SlGRAS24 mRNA was most abundant in stamens where Sly‐miR171 mRNA expression was at its lowest level. [score:3]
We hypothesized that there is functional redundancy among GRAS family members or multiple miR171 target genes in tomato. [score:3]
In the same year, two Arabidopsis orthologs of Petunia HAM were proved to be endogenous targets of post‐transcriptional degradation by miR171, a member of a miRNA family conserved in different plant species (Llave et al., 2002). [score:3]
In barley and rice, overexpression of miR171 affects phase transitions and floral meristem determinacy (Curaba et al., 2013; Fan et al., 2015). [score:3]
The miR171‐GRAS regulatory network participates in various physiological processes, including shoot meristem maintenance, axillary bud formation, flowering time, chlorophyll biosynthesis and trichome distribution. [score:2]
Actually, a total of three GRAS genes are regulated by miR171 in Arabidopsis, SCL6/SCL6‐IV, SCL22/SCL6‐III and SCL27/SCL6‐II (also known as the HAM or LOM (LOST MERISTEMS) genes because of their mutant phenotypes) (Reinhart et al., 2002). [score:2]
We hypothesized that the SlGRAS24 gene and its regulator Sly‐miR171 would have similar functions in tomato as their respective orthologs in Arabidopsis (Wang et al., 2010). [score:2]
Moreover, it has been extensively studied about the role of miR171 upon various stresses in different species, including Arabidopsis, barley, maize and Solanum tuberosum (Hwang et al., 2011; Kantar et al., 2010; Kong et al., 2010; Liu et al., 2008). [score:1]
In Arabidopsis, the miR171‐ GRAS module has been clarified as key player in meristem maintenance. [score:1]
We investigated this first by quantifying the expression of Sly‐miR171 and SlGRAS24 in the ‘Micro‐Tom’ cultivar (WT) by qRT‐PCR. [score:1]
A, Tissue profiling analysis of Sly‐miR171 (a, c) and Sl GRAS24 (b, d) in different organs of wild‐type tomato. [score:1]
The miR171 precursor and SlGRAS24 full‐length coding sequence were cloned into the modified binary vector pLP100 in the sense orientation, while the partial SlGRAS24 coding sequence was cloned in the antisense orientation, all under the CaMV 35S promoter. [score:1]
Overall, Sly‐miR171 and SlGRAS24 mRNAs had similar transcription patterns, which were consistent with research on their Arabidopsis orthologs (Wang et al., 2010). [score:1]
SlGRAS24 contains a conserved MIR‐binding sequence which is perfectly matched with Sly‐miR171 (Huang et al., 2015). [score:1]
Hwang, E. W., Shin, S. J., Yu, B. K., Byun, M. O. and Kwon, H. B. (2011) miR171 family members are involved in drought response in Solanum tuberosum. [score:1]
Four DNA fragments, the SlGRAS24 promoter, the precursor of miR171, the full‐length SlGRAS24 coding sequence and a partial SlGRAS24 coding sequence were amplified from tomato genomic DNA or cDNA. [score:1]
[1 to 20 of 31 sentences]
2
[+] score: 51
miRNA Fold (↑ or ↓) Target protein class Function References miR160 ↓, 2X Auxin response factors Hormone signaling and plant development[50] miR162 ↑, 2X Dicer-like (DCL) protein Plant development[39] miR168 ↑, 2X ARGONAUTE (AGO) protein Plant development[40, 51] miR169 ↓, 2X CBF HAP2-like factors Abiotic stress responses[52] miR171 ↓, 2X Scarecrow- like (GRAS domain) TFs Flowering time[11] miR172 ↑, ~4X APETALA-2 (AP2) like TFs Floral identity and phase transition[13, 17] miR319 ↑, ~4X TCP, bHLH TF Leaf patterning[19] miR391 ↓, 3X Not known Not known miR396 ↑, 2X GRL TFs, Rhodanase like proteins Defense responses[23] miR397 ↑, 1.5X Laccases, b -6 tubulin Fungal infection[7, 23] miR398 ↑, 3X Copper superoxide dismutases (CSD1/2) Abiotic stress[43] miR408 ↑, 1.5X Plantacyanin Stress responses[23] miR447 ↑, 2.5X 2-Phosphoglycerate kinase Metabolic pathway[7]The relative expression values of the individual miRNAs as revealed from the array analysis have been plotted as a histogram (see Additional file 1; Fig. S 2 a, b). [score:8]
Drastic down-regulation (~10 folds) was observed in the expression of pre- miR166a and pre-miR166b (targeting HD-ZIP transcription factors) while pre-miR171 was found to be reduced by two folds (Figure 5a). [score:8]
miRNA Fold (↑ or ↓) Target protein class Function References miR160 ↓, 2X Auxin response factors Hormone signaling and plant development[50] miR162 ↑, 2X Dicer-like (DCL) protein Plant development[39] miR168 ↑, 2X ARGONAUTE (AGO) protein Plant development[40, 51] miR169 ↓, 2X CBF HAP2-like factors Abiotic stress responses[52] miR171 ↓, 2X Scarecrow- like (GRAS domain) TFs Flowering time[11] miR172 ↑, ~4X APETALA-2 (AP2) like TFs Floral identity and phase transition[13, 17] miR319 ↑, ~4X TCP, bHLH TF Leaf patterning[19] miR391 ↓, 3X Not known Not known miR396 ↑, 2X GRL TFs, Rhodanase like proteins Defense responses[23] miR397 ↑, 1.5X Laccases, b -6 tubulin Fungal infection[7, 23] miR398 ↑, 3X Copper superoxide dismutases (CSD1/2) Abiotic stress[43] miR408 ↑, 1.5X Plantacyanin Stress responses[23] miR447 ↑, 2.5X 2-Phosphoglycerate kinase Metabolic pathway[7] The relative expression values of the individual miRNAs as revealed from the array analysis have been plotted as a histogram (see Additional file 1; Fig. S 2 a, b). [score:8]
, miR395, miR397 and miR399 were up-regulated both in leaves and flowers (Figure 5a and 5b) while pre-miR159 and pre-miR171 were down-regulated by 2 folds in flower tissues (Figure 5b). [score:7]
Microarray and northern hybridization results show that most of the deregulated miRNAs were induced and only few (miR160, miR164, miR169, miR171 and miR391) were down-regulated following ToLCNDV infection. [score:5]
Scarecrow-like TF SCL6 is targeted by miR171 and is demonstrated to play roles in developmental patterning [11]. [score:4]
The expression levels of miR164 and miR171 were markedly reduced in ToLCNDV (2A+2B) infected leaf samples. [score:3]
We chose SCL6- like TF, NAM-like TF and CBF TF that are targets of miR171, miR164 and miR169, respectively. [score:3]
Similar to miR164, modest reduction (~ 3 folds) was also observed in the expression of miR171 in ToLCNDV infected leaves (see Additional file 1; Fig. S 3, lane 2) compared to both healthy Pusa Ruby and LA1777 leaves. [score:2]
It may be noted that miR159 and miR171 show high sequence similarity to miR319 and miR170, respectively. [score:1]
The DNA oligos used as probes for northern analysis are given below: miR159: 5' - TAGAGCTCCCTTCAATCCAAA- 3'; miR164: 5' - TGCACGTGCCCTGCTTCTCCA- 3'; miR171: 5' - AGATGATATTGGCACGGCTCA- 3'; miR172: 5' - ATGCAGCATCATCAAGATTCT -3'; miR319: 5' - CTTGGACTGAAGGGAGCTCC-3'; Total RNA from healthy Pusa Ruby, ToLCNDV (2A+2B) agroinfected Pusa Ruby and LA1777 leaves and flowers was prepared using an RNeasy plant mini kit (Qiagen). [score:1]
The DNA oligos used as probes for northern analysis are given below: miR159: 5' - TAGAGCTCCCTTCAATCCAAA- 3'; miR164: 5' - TGCACGTGCCCTGCTTCTCCA- 3'; miR171: 5' - AGATGATATTGGCACGGCTCA- 3'; miR172: 5' - ATGCAGCATCATCAAGATTCT -3'; miR319: 5' - CTTGGACTGAAGGGAGCTCC-3'; Total RNA from healthy Pusa Ruby, ToLCNDV (2A+2B) agroinfected Pusa Ruby and LA1777 leaves and flowers was prepared using an RNeasy plant mini kit (Qiagen). [score:1]
[1 to 20 of 12 sentences]
3
[+] score: 48
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR396e, mtr-MIR166a, mtr-MIR169a, mtr-MIR399b, mtr-MIR399d, mtr-MIR393a, mtr-MIR399c, mtr-MIR399a, mtr-MIR399e, mtr-MIR156a, mtr-MIR171a, mtr-MIR156b, mtr-MIR167a, mtr-MIR166b, mtr-MIR169c, mtr-MIR169d, mtr-MIR169e, mtr-MIR171b, mtr-MIR166c, mtr-MIR166d, mtr-MIR169f, mtr-MIR156c, mtr-MIR156d, mtr-MIR399f, mtr-MIR399g, mtr-MIR399h, mtr-MIR399i, mtr-MIR399j, mtr-MIR399k, mtr-MIR166e, mtr-MIR156e, mtr-MIR171c, mtr-MIR398a, mtr-MIR172a, mtr-MIR393b, mtr-MIR398b, mtr-MIR168a, mtr-MIR169g, mtr-MIR156f, mtr-MIR399l, mtr-MIR156g, mtr-MIR399m, mtr-MIR399n, mtr-MIR399o, mtr-MIR398c, mtr-MIR156h, mtr-MIR166f, mtr-MIR166g, mtr-MIR171d, mtr-MIR171e, mtr-MIR396a, mtr-MIR396b, mtr-MIR169h, mtr-MIR169b, mtr-MIR156i, mtr-MIR171f, mtr-MIR399p, osa-MIR169r, sly-MIR166a, sly-MIR166b, sly-MIR167a, sly-MIR169a, sly-MIR169b, sly-MIR169c, sly-MIR169d, sly-MIR171a, sly-MIR171b, sly-MIR171c, sly-MIR171d, sly-MIR397, sly-MIR156a, sly-MIR156b, sly-MIR156c, sly-MIR172a, sly-MIR172b, sly-MIR399, osa-MIR827, osa-MIR396f, mtr-MIR2118, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, mtr-MIR169k, mtr-MIR169j, mtr-MIR399q, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR5072, mtr-MIR4414a, mtr-MIR4414b, mtr-MIR482, mtr-MIR172b, mtr-MIR172c, mtr-MIR171h, mtr-MIR168b, mtr-MIR399r, mtr-MIR156j, sly-MIR482e, sly-MIR482a, mtr-MIR167b, mtr-MIR168c, mtr-MIR408, mtr-MIR396c, mtr-MIR171g, stu-MIR6024, sly-MIR6024, stu-MIR482c, stu-MIR482b, stu-MIR482a, stu-MIR482d, stu-MIR482e, sly-MIR482b, sly-MIR482c, stu-MIR6025, stu-MIR6026, sly-MIR6026, sly-MIR168a, sly-MIR168b, mtr-MIR169i, mtr-MIR172d, mtr-MIR397, mtr-MIR169l, mtr-MIR399s, mtr-MIR399t, stu-MIR7980a, stu-MIR7983, stu-MIR8007a, stu-MIR8007b, stu-MIR7980b, stu-MIR399a, stu-MIR399b, stu-MIR399c, stu-MIR399d, stu-MIR399e, stu-MIR399f, stu-MIR399g, stu-MIR399h, stu-MIR3627, stu-MIR171b, stu-MIR166a, stu-MIR166b, stu-MIR166c, stu-MIR166d, stu-MIR171a, stu-MIR171c, stu-MIR399i, stu-MIR827, stu-MIR172b, stu-MIR172c, stu-MIR172a, stu-MIR172d, stu-MIR172e, stu-MIR156a, stu-MIR156b, stu-MIR156c, stu-MIR156d, stu-MIR171d, stu-MIR167c, stu-MIR167b, stu-MIR167a, stu-MIR167d, stu-MIR399j, stu-MIR399k, stu-MIR399l, stu-MIR399m, stu-MIR399n, stu-MIR399o, stu-MIR393, stu-MIR398a, stu-MIR398b, stu-MIR396, stu-MIR408a, stu-MIR408b, stu-MIR397, stu-MIR171e, stu-MIR156e, stu-MIR156f, stu-MIR156g, stu-MIR156h, stu-MIR156i, stu-MIR156j, stu-MIR156k, stu-MIR169a, stu-MIR169b, stu-MIR169c, stu-MIR169d, stu-MIR169e, stu-MIR169f, stu-MIR169g, stu-MIR169h, sly-MIR403, sly-MIR166c, sly-MIR156d, sly-MIR156e, sly-MIR396a, sly-MIR167b, sly-MIR482d, sly-MIR169e, sly-MIR396b, sly-MIR172c, sly-MIR408, sly-MIR172d, sly-MIR827, sly-MIR393, sly-MIR398a, sly-MIR399b, sly-MIR6025, sly-MIR169f, sly-MIR171f
In M. trunctula, one member of miR171 family (miR171h) regulates AM symbiosis by directly targeting the NSP2 gene (Lauressergues et al., 2012; Hofferek et al., 2014). [score:5]
The up-regulation of miR171 and miR171g in tomato revealed by this study, therefore suggests that a conserved miRNA family was adopted by different plant lineages to regulate AM symbiosis. [score:5]
The predicted down-regulation of this gene by miR171e-5p may prevent the digestion of R. irregularis cell wall by its host. [score:4]
The direct regulation of miR171 on NPS2 has recently been validated in vitro and miR171h can directly influence the AM in M. trunctula (Lauressergues et al., 2012; Hofferek et al., 2014). [score:4]
Cleavage of miR171 on scarecrow-like proteins is one of the earliest evidenced miRNA-target interactions in plants (Llave et al., 2002b). [score:3]
We identified six AM symbiosis responsive known miRNAs in tomato and revealed that two of the miR171 family members, miR171 and miR171g in tomato, are also capable of targeting NSP2. [score:3]
Besides NSP2, miR171 and miR171g have two other common targets, Solyc08g078800.1.1 and Solyc01g090950.2.1. [score:3]
Our data revealed that two members of miR171 family (miR171 and miR171g) were predicted to target an NSP2 ortholog with low mismatch penalties and also supported by the degradome. [score:3]
Another AM symbiosis responsive miR171 member is miR171e-5p, which has different predicted target gene with the above miR171 members. [score:3]
Besides NSP2, tomato miR171 and miR171g have another two common targets, Solyc08g078800.1.1 and Solyc01g090950.2.1, which are both annotated as scarecrow-like proteins. [score:3]
This further suggested that some miR171 members might function as common regulators of AM symbiosis in different plant lineages. [score:2]
Therefore, whether the regulation of scarecrow-like proteins by miR171 members has a role in AM symbiosis is interesting. [score:2]
Interestingly, tomato miR171 and miR171g actually share high sequence identity with a miRNA named Mtr-miR171h, which has been reported to regulate AM symbiosis in M. truncatula (Lauressergues et al., 2012; Hofferek et al., 2014). [score:2]
These results suggest that miR171 family may serve as a common regulator of AM symbiosis. [score:2]
MiR171 and miR397 are associated with nodule infection and the nitrogen-fixing ability of Lotus japonicus (De Luis et al., 2012). [score:1]
Five miRNA families (miR399, miR156, miR166, miR171, and miR172) had more than 10 members, and miR156 family, the largest family, had 23 members. [score:1]
Three of them were miR171 family members, including miR171, miR171g, and miR171i. [score:1]
Both of the two genes are annotated as scarecrow-like proteins and their cleavage by miR171 has been validated previously (Huang et al., 2015). [score:1]
[1 to 20 of 18 sentences]
4
[+] score: 44
Other miRNAs from this paper: sly-MIR171a, sly-MIR171b, sly-MIR171c, sly-MIR171d, sly-MIR171f
To study the role of miR171 -targeted SlHAM and SlHAM2 (collectively referred to as SlHAMs) in tomato meristems, we utilized the OP/LhG4 transactivation system to silence them by overexpressing sly-miR171a, which directs the cleavage of both genes, or sly-miR171b that additionally cleaves SlNSP2L (Supplementary Fig. S2A). [score:6]
Using the psRNATarget web server (Dai and Zhao, 2011) and applying a mismatch score of ≤2.0, we predicted four putative sly-miR171 targets from the available tomato gene mo dels (ITAG release 2.30) (Supplementary Fig. S1A). [score:5]
Quantitation of sly-miR171 -targeted genes in FIL>>MIR171b leaf primordia confirmed a significant reduction in the expression levels of SlHAMs compared with that of the control (Supplementary Fig. S4A). [score:4]
Sly-miR171 expression levels were determined relative to the control after normalization to the U6 snRNA and are indicated below each panel. [score:3]
This analysis identified several responder lines that strongly expressed the respective sly-miR171 upon transactivation (Supplementary Fig. S2B) from which we selected OP:MIR171a-4 (hereafter OP:MIR171a) and OP:MIR171b-20 (hereafter OP:MIR171b) for further analysis (Supplementary Fig. S2B). [score:3]
The Arabidopsis thaliana (Arabidopsis) genome encodes four HAM (AtHAM)/LOST MERISTEM (LOM) homologs, of which AtHAM1–AtHAM3 are targeted by miR171 (Llave et al., 2002; Wang et al., 2010). [score:3]
Quantitation of sly-miR171 -targeted genes in the young inflorescence with flower buds <1 mm in size revealed a significant ~65% reduction of SlHAM and SlHAM2 in AP1>>MIR171a and AP1>>MIR171b, whereas no significant reduction in SlNSP2L levels was detected in these plants, which is consistent with its less efficient silencing in shoot apices (Fig. 3A). [score:3]
Fig. 1. Phenotypic and molecular analyses of sly-miR171 -overexpressing seedlings. [score:3]
Analysis of RNA from leaves, flower buds, and flowers by RLM-RACE confirmed sly-miR171-directed endonucleolytic cleavage of Solyc08g078800 (SlHAM), Solyc01g090950, and Solyc11g013150. [score:2]
Sly-miR171 gel-blot analysis of total RNA was performed as described previously (Hen delman et al., 2013) using a complementary radiolabeled oligonucleotide as a probe. [score:1]
Four members of the tomato miR171 family have been cloned to date, of which sly-miR171a and sly-miR171b are offset by three nucleotides relative to each other (Moxon et al., 2008). [score:1]
Total RNA extraction and sly-miR171 gel-blot analysis. [score:1]
Characterization of sly-miR171 predicted target genes. [score:1]
Constitutively activated 35S>>MIR171a and 35S>>MIR171b F [1] progeny seedlings accumulated ~3-fold higher levels of corresponding sly-miR171 than the control (Fig. 1A) and that was accompanied by significantly lower levels of SlHAMs transcripts (Fig. 1B). [score:1]
The Solyc02g085600 protein was found in the HAM subclade but shares the highest similarity with AtHAM4, which also does not undergo miR171 -guided cleavage (Engstrom et al., 2010), and accordingly was named SlHAM4. [score:1]
Cytokinin HAM leaf meristem miR171 tomato WUSCHEL. [score:1]
The functionality of this interaction is supported by their co-localization in the SAM and the observation that the Atham1,2,3 loss-of-function mutant and the Atham4- pWUS:MIR171 mutant display defects similar to those observed in wus7 and wus1 mutants, respectively. [score:1]
Following transformation into M82 tomato, 12 OP:MIR171a and five OP:MIR171b responder plants were obtained and their F [1] progeny characterized for corresponding mature miR171 overexpression following a cross with the 35S:LhG4 driver line. [score:1]
The tomato miR171 (sly-miR171) guides the cleavage of three GRAS-like genes. [score:1]
In contrast, the Solyc02g085600 cleavage product was not recovered by us, consistent with its absence in published tomato degradome data (Karlova et al., 2013), suggesting that it is not subject to significant sly-miR171 -mediated cleavage. [score:1]
Sly-miR171 cleavage site mapping. [score:1]
[1 to 20 of 21 sentences]
5
[+] score: 29
Other miRNAs from this paper: sly-MIR171a, sly-MIR171b, sly-MIR171c, sly-MIR171d, sly-MIR171f
Moreover, DI-miR repRNA carrying the miR171 target sequence in the (-)strand RNA replicated poorly in N. benthamiana leaves expressing dominant negative ESCRT-III mutants (Fig. 4B). [score:5]
Note that both copies of the miR171 target sequence were present in the (−)strand RNA generated during repRNA replication only in plants agroinfiltrated with constructs expressing p33/p92/dominant negative ESCRT proteins and DI-72 or DI-miR repRNAs. [score:5]
The plasmid pYC/DI72sat/2xmiR171 was designed to express a modified DI-72 repRNA containing two miR171 target sites [50], between regions I and II and regions II and III, from a 35S promoter in N. benthamiana plants. [score:5]
The repRNA carrying the miR target sequences (called DI-miR, Fig. 4A) accumulated to ∼60% level of the wt repRNA (DI-72) lacking the miR171 target sequence (Fig. 4B, lanes 1-2 versus 3–4) in the control plants. [score:5]
The orientation of both copies of miR171 sequence was to allow cleavage of the target when present in the (−)strand of the repRNA. [score:3]
We introduced two microRNA171 (miR171) sequences to the repRNA in such a way that the miR171 sequences were active targets to the RNAi machinery only when present in the (−)repRNA (Fig. 4). [score:3]
Two copies of the 21 nt long miR171 target sequence were inserted into DI-72 repRNA to generate DI-miR repRNA as shown. [score:3]
[1 to 20 of 7 sentences]
6
[+] score: 27
Other miRNAs from this paper: sly-MIR171a, sly-MIR171b, sly-MIR171c, sly-MIR171d, sly-MIR171f
org/psRNATarget/) showed that another member of HAM subfamily, SlGRAS8, can also bind Sly-miR171 mature sequence and was predicted to be regulated through translational repression rather than mRNA cleavage, suggesting that a complicated regulatory mechanism of Sly-miR171 and its target genes in tomato. [score:9]
However, the expression patterns of SlGRAS24 and SlGRAS40 in tomato are largely different, which suggests that the complicated and widespread functions of the miR171-GRASs regulatory networks in tomato. [score:4]
Ma ZX Hu XP Cai WJ Huang WH Zhou X Luo Q Arabidopsis miR171-Targeted Scarecrow-Like Proteins Bind to GT cis-Elements and Mediate Gibberellin-Regulated Chlorophyll Biosynthesis under Light ConditionsPlos Genetics. [score:4]
SlGRAS24 and SlGRAS40 were identified as target genes of miR171 using5’-RACE (Rapid amplification of cDNA ends). [score:3]
In Arabidopsis, 3 GRAS proteins of this group are post-transcriptionally regulated by miR171 (AtSCL6, 22, 27) [42, 43]. [score:2]
Sequencing results showed that the complementary sequences of each gene to Sly-miR171 mature sequence as well as the cleavage sites were exactly the same (Fig.   5). [score:1]
Both SlGRAS24 and SlGRAS40 were cleaved between 10 [th] and 11 [th], 13 [th] and 14 [th] nt of mature miR171 sequence (arrows) In addition, to further explore the orthologous relationships of GRAS genes between tomato and other Solanaceae crops, 50 and 30 GRAS genes from potato (Solanum tuberosum) and pepper (Capsicum annuum), respectively, were selected to construct another phylogenetic tree (Additional file 4). [score:1]
Both SlGRAS24 and SlGRAS40 were cleaved between 10 [th] and 11 [th], 13 [th] and 14 [th] nt of mature miR171 sequence (arrows)In addition, to further explore the orthologous relationships of GRAS genes between tomato and other Solanaceae crops, 50 and 30 GRAS genes from potato (Solanum tuberosum) and pepper (Capsicum annuum), respectively, were selected to construct another phylogenetic tree (Additional file 4). [score:1]
Here, the closest homologs of these Arabidopsis genes in tomato are the two genes, SlGRAS24 and SlGRAS40, both having a putative binding site for Sly-miR171. [score:1]
Members in the same sub-branch were marked by circle filled with same color Fig. 5Cleavage sites of miR171 at complementary sequences of SlGRAS24 and SlGRAS40 determined by 5’-RACE. [score:1]
[1 to 20 of 10 sentences]
7
[+] score: 27
Using psRNAtarget Analysis server, conserved miRNAs including, miR164(i), miR171(i), miR159(i), miR394(i), miR156(i), miR482(ii), miR166(i), and miR168(i) were predicted to target genes including NAC, GRAS, GAMYB-like, Peroxiredoxin, SBP, Resistance protein, HB and AGO-1, respectively. [score:5]
Among the validated tomato miRNA targets, SBP, NAC, GAMYB-like, HB and GRAS transcription factors, targets of conserved miRNAs, miR156(i), miR164(i), miR159(i), miR166(i) and miR171(i), respectively were enriched under GO term, transcription factor activity. [score:5]
The cleavage site of Sly_miRNA996 on its target lies between 13 [th] and 14 [th] base from 5’ end of miRNA binding which is similar to the cleavage position of target gene (GRAS) of miR171(i) (Fig 5). [score:5]
0175178.g005 Fig 5Using psRNAtarget Analysis server, conserved miRNAs including, miR164(i), miR171(i), miR159(i), miR394(i), miR156(i), miR482(ii), miR166(i), and miR168(i) were predicted to target genes including NAC, GRAS, GAMYB-like, Peroxiredoxin, SBP, Resistance protein, HB and AGO-1, respectively. [score:5]
For example, known targets, SBP, NAC, GRAS, HB, GRF, GAMYB-like and TCP24 transcription factors were predicted for miR156(i), miR164(i), miR171(i), miR166(i), miR396(i), miR159(i) and miR319(i), respectively in our study. [score:3]
In contrast, a low digital expression was observed for miR1446, miR167, miR169, miR171, miR393, miR394, miR399, miR408, miR5304, miR9473 and miR9479 families (total TPM value < 100). [score:3]
The transcription factor gene, GRAS (Solyc08g078800.1) was shown to be cleaved by miR171(i) between 13 [th] and 14 [th] base from 5’ end binding of miRNA. [score:1]
[1 to 20 of 7 sentences]
8
[+] score: 15
Sly‐miR171, sly‐miR403 and sly‐miR6027 families targeted histone‐arginine methyltransferase involved in cellular and developmental process, and sly‐miR395 and sly‐miR9477 degraded acyltransferase gene, the cellular and metabolic process‐associated target (Table S4). [score:6]
These targets were cleaved by sly‐miR156, sly‐miR164, sly‐miR166, sly‐miR169, sly‐miR171, sly‐miR395 and sly‐mir9477 (Table S4). [score:3]
Drought‐responsive miRNAs (such as sly‐miR160, sly‐miR165, sly‐miR166, sly‐miR171, sly‐miR398, sly‐miR408, sly‐miR827, sly‐miR9472, sly‐miR9476 and sly‐miR9552) regulated drought and development‐associated genes like DRP, HD‐ZIP, MYB, NAC and PSII in root and upground tissues (Figure  11a). [score:3]
miR160, miR165, miR166, miR171, miR398, miR408, miR827, miR9472, miR9476 and miR9552 were the key mi RNAs functioning in regulation of these genes and involving in tomato response to drought stress. [score:2]
Among 578 families, sly‐miR171 was represented with seven members, as the largest one, followed by sly‐miR166 and sly‐miR319 with five members (Table S2). [score:1]
[1 to 20 of 5 sentences]
9
[+] score: 8
Most of the conserved miRNAs (such as miR156, miR159, miR160, miR164, miR167, miR171, miR172, miR319, and some others) usually target a range of transcription factors like MYBs, ARFs, SBPs, NACs, AP2-like factors, GRFs, and GRASs, and their miRNAs -mediated regulations are important for plant growth and development and may act in the core gene expression networks (Liu et al., 2013). [score:7]
Micro RNA families MIR156, MIR172, and MIR5303 contained highest five members while 11 families viz, MIR162, MIR166, MIR167, MIR168, MIR171, MIR1919, MIR319, MIR398, MIR482, MIR6024, and MIR7997 contained several members (2–4). [score:1]
[1 to 20 of 2 sentences]
10
[+] score: 7
A total of 29 DE genes were predicted targets of 11 tomato miRNAs (Table 2): four of them (miR156, miR159, miR171, miR172) were developmental miRNAs, conserved between plant families, and seven were family- (miR6022, miR6023, miR6024, miR6027, miR5303) or species-specific (miR1917, miR1918) miRNAs. [score:4]
Transcript AK319459 coding for an unknown protein repressed (FC = 0.74) in infected plants is targeted by Sly-miR171, known for its role in controlling the transitions from juvenile to adult, and from adult to reproductive phases [39]. [score:3]
[1 to 20 of 2 sentences]
11
[+] score: 6
Other miRNAs from this paper: sly-MIR171a, sly-MIR171b, sly-MIR171c, sly-MIR171d, sly-MIR171f
Overexpression of a tomato miR171 target gene SlGRAS24 impacts multiple agronomical traits via regulating gibberellin and auxin homeostasis. [score:6]
[1 to 20 of 1 sentences]
12
[+] score: 5
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR396e, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR172a, gma-MIR172b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR156b, gma-MIR169a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR171b, gma-MIR482a, sly-MIR160a, sly-MIR166a, sly-MIR166b, sly-MIR167a, sly-MIR169a, sly-MIR169b, sly-MIR169c, sly-MIR169d, sly-MIR171a, sly-MIR171b, sly-MIR171c, sly-MIR171d, sly-MIR395a, sly-MIR395b, sly-MIR156a, sly-MIR156b, sly-MIR156c, sly-MIR159, sly-MIR162, sly-MIR172a, sly-MIR172b, osa-MIR396f, gma-MIR167d, gma-MIR396c, mdm-MIR482a, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR394b, gma-MIR156g, gma-MIR159d, gma-MIR394a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR394c, gma-MIR408d, gma-MIR482c, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, sly-MIR482e, sly-MIR482a, gma-MIR171j, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR167j, gma-MIR171l, gma-MIR156p, gma-MIR171m, gma-MIR172k, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR172l, gma-MIR169o, gma-MIR171p, gma-MIR394d, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR482e, gma-MIR171r, gma-MIR394e, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR394f, gma-MIR171u, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, sly-MIR482b, sly-MIR482c, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR394g, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, mdm-MIR156a, mdm-MIR156b, mdm-MIR156c, mdm-MIR156d, mdm-MIR156e, mdm-MIR156f, mdm-MIR156g, mdm-MIR156h, mdm-MIR156i, mdm-MIR156j, mdm-MIR156k, mdm-MIR156l, mdm-MIR156m, mdm-MIR156n, mdm-MIR156o, mdm-MIR156p, mdm-MIR156q, mdm-MIR156r, mdm-MIR156s, mdm-MIR156t, mdm-MIR156u, mdm-MIR156v, mdm-MIR156w, mdm-MIR156x, mdm-MIR156y, mdm-MIR156z, mdm-MIR156aa, mdm-MIR156ab, mdm-MIR156ac, mdm-MIR156ad, mdm-MIR156ae, mdm-MIR159a, mdm-MIR159b, mdm-MIR160a, mdm-MIR160b, mdm-MIR160c, mdm-MIR160d, mdm-MIR160e, mdm-MIR162a, mdm-MIR162b, mdm-MIR164a, mdm-MIR164b, mdm-MIR164c, mdm-MIR164d, mdm-MIR164e, mdm-MIR164f, mdm-MIR166a, mdm-MIR166b, mdm-MIR166c, mdm-MIR166d, mdm-MIR166e, mdm-MIR166f, mdm-MIR166g, mdm-MIR166h, mdm-MIR166i, mdm-MIR167a, mdm-MIR167b, mdm-MIR167c, mdm-MIR167d, mdm-MIR167e, mdm-MIR167f, mdm-MIR167g, mdm-MIR167h, mdm-MIR167i, mdm-MIR167j, mdm-MIR169a, mdm-MIR169b, mdm-MIR169c, mdm-MIR169d, mdm-MIR171a, mdm-MIR171b, mdm-MIR171c, mdm-MIR171d, mdm-MIR171e, mdm-MIR171f, mdm-MIR171g, mdm-MIR171h, mdm-MIR171i, mdm-MIR171j, mdm-MIR171k, mdm-MIR171l, mdm-MIR171m, mdm-MIR171n, mdm-MIR172a, mdm-MIR172b, mdm-MIR172c, mdm-MIR172d, mdm-MIR172e, mdm-MIR172f, mdm-MIR172g, mdm-MIR172h, mdm-MIR172i, mdm-MIR172j, mdm-MIR172k, mdm-MIR172l, mdm-MIR172m, mdm-MIR172n, mdm-MIR172o, mdm-MIR394a, mdm-MIR394b, mdm-MIR395a, mdm-MIR395b, mdm-MIR395c, mdm-MIR395d, mdm-MIR395e, mdm-MIR395f, mdm-MIR395g, mdm-MIR395h, mdm-MIR395i, mdm-MIR396a, mdm-MIR396b, mdm-MIR396c, mdm-MIR396d, mdm-MIR396e, mdm-MIR396f, mdm-MIR396g, mdm-MIR408a, mdm-MIR482b, mdm-MIR482c, mdm-MIR408b, mdm-MIR408c, mdm-MIR408d, mdm-MIR482d, mdm-MIR159c, mdm-MIR171o, mdm-MIR169e, mdm-MIR169f, sly-MIR164a, sly-MIR164b, sly-MIR394, sly-MIR166c, sly-MIR156d, sly-MIR156e, sly-MIR396a, sly-MIR167b, sly-MIR482d, sly-MIR169e, sly-MIR396b, gma-MIR167k, gma-MIR167l, gma-MIR169w, sly-MIR172c, sly-MIR408, sly-MIR172d, sly-MIR169f, sly-MIR171f, mdm-MIR159d, mdm-MIR159e, mdm-MIR159f, mdm-MIR166j, mdm-MIR395j, mdm-MIR169g, mdm-MIR169h, mdm-MIR169i, mdm-MIR169j, mdm-MIR171p, mdm-MIR395k, mdm-MIR171q, mdm-MIR169k, mdm-MIR169l, mdm-MIR169m, mdm-MIR169n, mdm-MIR172p, mdm-MIR395l, mdm-MIR169o
However, target genes for miR167 were detected only in predicted gene mo dels, and miR171 had predicted target genes only in mesocarp cDNA sequences. [score:5]
[1 to 20 of 1 sentences]
13
[+] score: 3
For example, scarecrow-like protein, ribosomal protein and TCP family transcription factors targeted by sha-miR171 (sha-miR171a, sha-miR171a_nta, sha-miR171b-3p_stu, sha-miR171c_mtr and sha-miR171d), sha-miR156i-p3_nta and sha-miR319b_stu, respectively, were mainly found in the CT library, which suggested that these miRNAs might play important roles in the chilling stress response, which was in agreement with the results reported in rice [27]. [score:3]
[1 to 20 of 1 sentences]
14
[+] score: 3
Furthermore, SCARECROW-LIKEA (SCL), which is the target of miR171, was involved in plant height [38]. [score:3]
[1 to 20 of 1 sentences]
15
[+] score: 2
Another analysis about GRAS proteins found that some members in the gene family are regulated by miRNA171; for instance, AT2G45160, AT3G60630, and AT4G00150 in Arabidopsis (Schulze et al., 2010), Pm017821 and Pm023512 in Prunus mume (Wang et al., 2014), Solyc01g090950.2.1 and Solyc08g078800.1.1 in tomato (Huang et al., 2015), and four genes in rice (Llave et al., 2002) are complementary to miRNA171. [score:2]
[1 to 20 of 1 sentences]
16
[+] score: 2
Some miRNAs (e. g., miR156, miR164, miR168, miR171, miR393, miR396, and miR398) are associated with a broad range of plant defense responses to stresses including drought, salt, and cold stresses [18]. [score:1]
The majority of the 26 miRNA families contained more than one member, and miR156, miR171, miR172, miR319, miR396, and miR482 had more than seven members. [score:1]
[1 to 20 of 2 sentences]
17
[+] score: 1
Several miRNA families, including miR157, miR159, miR162, miR164, miR167, miR171, miR172, miR390, miR396, and miR482, were moderately abundant (Figure  2A). [score:1]
[1 to 20 of 1 sentences]
18
[+] score: 1
The numbers of miRNAs varied in different miRNA families, with the most members (seven) in sly-miR156 and sly-miR482, followed with five miRNAs in the family of sly-miR171. [score:1]
[1 to 20 of 1 sentences]
19
[+] score: 1
Most of the families had several members, with exception of miR171, miR393, miR398, miR403, miR530, miR858, miR4414, miR8577, miR9471, and miR9474, which were represented only by one member in both libraries (Additional file 1: Table S1). [score:1]
[1 to 20 of 1 sentences]
20
[+] score: 1
MiR171 and miR319 were the second largest family with six members. [score:1]
[1 to 20 of 1 sentences]
21
[+] score: 1
On the other hand, certain miRNAs (e. g., miR171) exhibited the opposite changes at the moderately and acutely elevated temperatures, perhaps because certain miRNAs responded differently to different elevated temperatures. [score:1]
[1 to 20 of 1 sentences]
22
[+] score: 1
This pattern is in contrast to the induction of tomato miR171e and miR4376 in response to the infection of PSTVd [16], attesting to the specific host responses. [score:1]
[1 to 20 of 1 sentences]
23
[+] score: 1
The members of each family were different, the miR156, miR166 and miR171 had more than ten members, in the contrary, miR160, miR319, miR394, miR395, miR399, miR408, miR472, miR482, miR827 had only one member in their corresponding family. [score:1]
[1 to 20 of 1 sentences]