sort by

1 publications mentioning bta-mir-3613a

Open access articles that are associated with the species Bos taurus and mention the gene name mir-3613a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 12
confirmed the down-regulation of 8 miRNAs (novel-miR-51, novel-miR-99, miR-30d, miR-574, miR-222, miR-196a, miR-3613a, and miR-27a-5p) and the up-regulation of 4 miRNAs (novel-miR-75, miR-1246, miR-2478, and miR-2904) in infected MDBK cells compared with the uninfected (Figure 4A). [score:6]
Primer Sequence (5′-3′) bta-miR-30d TGTAAACATCCCCGACTGGAAGCT bta-miR-574 TGAGTGTGTGTGTGTGAGTGTGTG bta-miR-222 GAGCTACATCTGGCTACTGGGT bta-miR-196a GGCTAGGTAGTTTCATGTTGTTGGG bta-miR-3613a GCGGCTGTTGTACTTTTTTTTTTGTTC bta-miR-1246 GGCAATGGATTTTTGGAGCAGG bta-miR-2478 GCCGTATCCCACTTCTGACACCA bta-miR-2904 GGGAGCCTCGGTTGGCCT bta-miR-27a-5p GGCTTCACAGTGGCTAAGTTCCG novel-miR-51 TAATACTGCCTGGTAATGATGAC novel-miR-99 TTGGGAAGCACAGACACTAGGACT novel-miR-75 TCAAAGACTCGGACGTGACTGA 5S rRNA-F GTCTACGGCCATACCACCCT Table 2 Primers used to detect target genes expression with RT-qPCR. [score:3]
Primer Sequence (5′-3′) bta-miR-30d TGTAAACATCCCCGACTGGAAGCT bta-miR-574 TGAGTGTGTGTGTGTGAGTGTGTG bta-miR-222 GAGCTACATCTGGCTACTGGGT bta-miR-196a GGCTAGGTAGTTTCATGTTGTTGGG bta-miR-3613a GCGGCTGTTGTACTTTTTTTTTTGTTC bta-miR-1246 GGCAATGGATTTTTGGAGCAGG bta-miR-2478 GCCGTATCCCACTTCTGACACCA bta-miR-2904 GGGAGCCTCGGTTGGCCT bta-miR-27a-5p GGCTTCACAGTGGCTAAGTTCCG novel-miR-51 TAATACTGCCTGGTAATGATGAC novel-miR-99 TTGGGAAGCACAGACACTAGGACT novel-miR-75 TCAAAGACTCGGACGTGACTGA 5S rRNA-F GTCTACGGCCATACCACCCT Table 2 Primers used to detect target genes expression with RT-qPCR. [score:3]
[1 to 20 of 3 sentences]