sort by

8 publications mentioning bta-mir-1246

Open access articles that are associated with the species Bos taurus and mention the gene name mir-1246. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 16
The expression of miR-223, miR-184, miR-132, miR-1246 and miR-130b were up-regulated while miR-196a, miR-205, miR-200b, miR-31 and miR-145 were down-regulated, which was in agreement with the high-throughput sequencing results (Figure 4). [score:9]
miRNA Target Genes miR-1246 ATP2B4, MAP3K1, ADCK3, PSD2, SLC5A1 miR-130b EXOC3L1, TIE1, BAZ2B, C3, GRAMD1C miR-145 HSD3B7, SLCO4A1, PDIA4, ACADL, PTPN11, KRT9, RASSF6, RNF43, LAMC2 miR-196a ADAP1, GPR97, POMT1 miR-200b ARID3A, MLXIP, GPR110 miR-205 IL13RA2, COL5A2, ADM, CXCR2, XPO6, SPSB1, FMO5, PSMF1 miR-31 MEX3D, PFKFB3, ST3GAL3, IL2RB, ANKRD32, MGST1 miR-184 HSPA1L, SLC25A15, HEG1, MAPRE2, ACP6, SYNE2 miR-223 TMEM165 miR-132 IQCA1 Figure 5 Gene ontology statistics. [score:3]
miRNA Target Genes miR-1246 ATP2B4, MAP3K1, ADCK3, PSD2, SLC5A1 miR-130b EXOC3L1, TIE1, BAZ2B, C3, GRAMD1C miR-145 HSD3B7, SLCO4A1, PDIA4, ACADL, PTPN11, KRT9, RASSF6, RNF43, LAMC2 miR-196a ADAP1, GPR97, POMT1 miR-200b ARID3A, MLXIP, GPR110 miR-205 IL13RA2, COL5A2, ADM, CXCR2, XPO6, SPSB1, FMO5, PSMF1 miR-31 MEX3D, PFKFB3, ST3GAL3, IL2RB, ANKRD32, MGST1 miR-184 HSPA1L, SLC25A15, HEG1, MAPRE2, ACP6, SYNE2 miR-223 TMEM165 miR-132 IQCA1 Figure 5 Gene ontology statistics. [score:3]
It is noteworthy that miR-1246 has the most significant difference (log2 = 8.41) in our study, yet there is very limited report on its function. [score:1]
[1 to 20 of 4 sentences]
2
[+] score: 12
confirmed the down-regulation of 8 miRNAs (novel-miR-51, novel-miR-99, miR-30d, miR-574, miR-222, miR-196a, miR-3613a, and miR-27a-5p) and the up-regulation of 4 miRNAs (novel-miR-75, miR-1246, miR-2478, and miR-2904) in infected MDBK cells compared with the uninfected (Figure 4A). [score:6]
Primer Sequence (5′-3′) bta-miR-30d TGTAAACATCCCCGACTGGAAGCT bta-miR-574 TGAGTGTGTGTGTGTGAGTGTGTG bta-miR-222 GAGCTACATCTGGCTACTGGGT bta-miR-196a GGCTAGGTAGTTTCATGTTGTTGGG bta-miR-3613a GCGGCTGTTGTACTTTTTTTTTTGTTC bta-miR-1246 GGCAATGGATTTTTGGAGCAGG bta-miR-2478 GCCGTATCCCACTTCTGACACCA bta-miR-2904 GGGAGCCTCGGTTGGCCT bta-miR-27a-5p GGCTTCACAGTGGCTAAGTTCCG novel-miR-51 TAATACTGCCTGGTAATGATGAC novel-miR-99 TTGGGAAGCACAGACACTAGGACT novel-miR-75 TCAAAGACTCGGACGTGACTGA 5S rRNA-F GTCTACGGCCATACCACCCT Table 2 Primers used to detect target genes expression with RT-qPCR. [score:3]
Primer Sequence (5′-3′) bta-miR-30d TGTAAACATCCCCGACTGGAAGCT bta-miR-574 TGAGTGTGTGTGTGTGAGTGTGTG bta-miR-222 GAGCTACATCTGGCTACTGGGT bta-miR-196a GGCTAGGTAGTTTCATGTTGTTGGG bta-miR-3613a GCGGCTGTTGTACTTTTTTTTTTGTTC bta-miR-1246 GGCAATGGATTTTTGGAGCAGG bta-miR-2478 GCCGTATCCCACTTCTGACACCA bta-miR-2904 GGGAGCCTCGGTTGGCCT bta-miR-27a-5p GGCTTCACAGTGGCTAAGTTCCG novel-miR-51 TAATACTGCCTGGTAATGATGAC novel-miR-99 TTGGGAAGCACAGACACTAGGACT novel-miR-75 TCAAAGACTCGGACGTGACTGA 5S rRNA-F GTCTACGGCCATACCACCCT Table 2 Primers used to detect target genes expression with RT-qPCR. [score:3]
[1 to 20 of 3 sentences]
3
[+] score: 8
MiR-1246 gene that encodes one of the most abundantly expressed miRNAs in FBS, is present in only 4 out of 223 species, including bovine, human, orangutan and chimpanzee, but not in mouse or rat 17. [score:3]
FBS-derived miR-1246 is detected in cultured mouse cells. [score:1]
MiR-122 was the most abundant miRNA in the FBS, followed by miR-1246, miR-423-5p, miR-148a-3p, and let-7 family (Fig. 1f). [score:1]
There are no sequences homologous to hsa-miR-1246 identified in the mouse genome. [score:1]
miR-1246 signal varied between the recipient cells lines, suggesting different levels of uptake and/or processing in the different cells. [score:1]
The miR-1246 signal was significantly reduced in cells that were switched to 10% vdFBS culture medium seven days prior to and undetectable in mouse tissues (Fig. 1h). [score:1]
[1 to 20 of 6 sentences]
4
[+] score: 3
The relative expression in HM and LM fractions of several of these knowns, including bta-miR-103, bta-miR-30b-5p, bta-miR-17-5p, bta-miR-106b, bta-miR-142-3p, bta-miR-34b, bta-miR-18a, bta-miR-34c, bta-miR-455-5p, bta-miR-10b, bta-miR-99b, bta-miR-1246, bta-miR-99a-5p, and bta-miR-1388-5p, was consistent with the relative abundance of their homologouss, observed in the normal vs abnormal sperm. [score:3]
[1 to 20 of 1 sentences]
5
[+] score: 2
Sakha S Muramatsu T Ueda K Inazawa J Exosomal microRNA miR-1246 induces cell motility and invasion through the regulation of DENND2D in oral squamous cell carcinomaSci. [score:2]
[1 to 20 of 1 sentences]
6
[+] score: 1
Also present were miR-1777b (6.71%), miR-1777a (4.88%), miR-1246 (4.42%), miR-126-3p (2.44%), miR-2305 (2.07%), miR-1584-5p (1.90%), miR-2413 (1.74%), miR-4286 (1.58%), miR-1224 (1.56%), and miR-451 (1.41%). [score:1]
[1 to 20 of 1 sentences]
7
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-99a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-99a, mmu-mir-140, mmu-mir-10b, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-191, hsa-mir-192, hsa-mir-148a, hsa-mir-30d, mmu-mir-122, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-122, hsa-mir-140, hsa-mir-191, hsa-mir-320a, mmu-mir-30d, mmu-mir-148a, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-21a, mmu-mir-22, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-92a-2, mmu-mir-25, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-92a-1, hsa-mir-26a-2, hsa-mir-423, hsa-mir-451a, mmu-mir-451a, hsa-mir-486-1, mmu-mir-486a, mmu-mir-423, bta-mir-26a-2, bta-let-7f-2, bta-mir-148a, bta-mir-21, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-140, bta-mir-92a-2, bta-let-7d, bta-mir-191, bta-mir-192, bta-mir-22, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, hsa-mir-1246, bta-mir-24-1, bta-mir-26a-1, bta-mir-451, bta-mir-486, bta-mir-92a-1, bta-mir-181a-1, bta-mir-320a-1, mmu-mir-486b, hsa-mir-451b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, hsa-mir-486-2
There were three microRNAs (bta-miR-1246, bta-miR-21-5p, and bta-miR-320a) that were identified in the present study, but unreported by. [score:1]
[1 to 20 of 1 sentences]
8
[+] score: 1
We note that miRDeep2 erroneously missed counting of bta-mir-1246 in the known list and assigned this as a novel miRNA; the reason for this is unclear. [score:1]
[1 to 20 of 1 sentences]