sort by

16 publications mentioning gma-MIR171o

Open access articles that are associated with the species Glycine max and mention the gene name MIR171o. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 30
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR166a, gma-MIR166b, gma-MIR168a, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR156b, gma-MIR169a, gma-MIR159b, gma-MIR159c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR171b, gma-MIR1507a, gma-MIR1509a, gma-MIR1510a, gma-MIR1515a, gma-MIR396c, gma-MIR1507b, gma-MIR1510b, gma-MIR1509b, gma-MIR396d, gma-MIR156f, gma-MIR169d, gma-MIR171c, gma-MIR169e, gma-MIR156g, gma-MIR159d, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR390c, gma-MIR398c, gma-MIR2118a, gma-MIR2118b, gma-MIR862a, gma-MIR1507c, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR171j, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR396h, gma-MIR396i, gma-MIR171l, gma-MIR2111a, gma-MIR393b, gma-MIR399a, gma-MIR828a, gma-MIR156p, gma-MIR828b, gma-MIR171m, gma-MIR171n, gma-MIR156q, gma-MIR169o, gma-MIR171p, gma-MIR169p, gma-MIR156r, gma-MIR399b, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR2111b, gma-MIR2111c, gma-MIR166k, gma-MIR2111d, gma-MIR156t, gma-MIR399c, gma-MIR171r, gma-MIR399d, gma-MIR399e, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR2111e, gma-MIR2111f, gma-MIR171u, gma-MIR399f, gma-MIR399g, gma-MIR166m, gma-MIR169u, gma-MIR399h, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR1515b, gma-MIR398d, gma-MIR399i, gma-MIR399j, gma-MIR399k, gma-MIR169w, gma-MIR399l, gma-MIR399m, gma-MIR399n, gma-MIR399o
Moreover, we identified six novel targets for the five phasiRNAs derived from gma-miR393 targets, eight novel targets for the five phasiRNAs derived from gma-miR1507 targets, 29 novel targets for the 22 phasiRNAs derived from gma-miR1510 targets, eight novel targets for the seven phasiRNAs derived from gma-miR1515 targets, five novel targets for the four phasiRNAs derived from gma-miR171 targets and 15 novel targets for the nine phasiRNAs derived from gma-miR2118 targets (Table S3). [score:25]
The secondary small RNAs derived from all identified miRNA targets by PsRobot [16] in soybean were searched, and four transcripts (Glyma01g33270.1, Glyma04g29220.3, Glyma09g02920.2, Glyma05g33260.1), targeted respectively by gma-miR171, gma-miR1507, gma-miR1515, and gma-miR2118, were identified to produce secondary siRNAs (Figure 3). [score:5]
[1 to 20 of 2 sentences]
2
[+] score: 17
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR156b, gma-MIR169a, gma-MIR159b, gma-MIR159c, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR171b, gma-MIR482a, gma-MIR1507a, gma-MIR1508a, gma-MIR1509a, gma-MIR1510a, gma-MIR1511, gma-MIR1512a, gma-MIR1514a, gma-MIR1514b, gma-MIR167d, gma-MIR396c, gma-MIR1507b, gma-MIR1508b, gma-MIR1510b, gma-MIR2109, gma-MIR2119, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR1509b, gma-MIR4345, gma-MIR396d, gma-MIR4369, gma-MIR482b, gma-MIR167g, gma-MIR4397, gma-MIR156f, gma-MIR4409, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR394b, gma-MIR4413a, gma-MIR156g, gma-MIR159d, gma-MIR394a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR390c, gma-MIR394c, gma-MIR398c, gma-MIR408d, gma-MIR2118a, gma-MIR2118b, gma-MIR482c, gma-MIR1507c, gma-MIR1508c, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR5373, gma-MIR403a, gma-MIR403b, gma-MIR171j, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR397a, gma-MIR397b, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR3522, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR1512b, gma-MIR1513c, gma-MIR4413b, gma-MIR167j, gma-MIR171l, gma-MIR1512c, gma-MIR5767, gma-MIR5770a, gma-MIR393b, gma-MIR5781, gma-MIR5770b, gma-MIR399a, gma-MIR156p, gma-MIR171m, gma-MIR172k, gma-MIR171n, gma-MIR156q, gma-MIR172l, gma-MIR169o, gma-MIR171p, gma-MIR394d, gma-MIR169p, gma-MIR156r, gma-MIR399b, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR482e, gma-MIR399c, gma-MIR171r, gma-MIR394e, gma-MIR399d, gma-MIR399e, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR394f, gma-MIR171u, gma-MIR399f, gma-MIR399g, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, gma-MIR399h, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR394g, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR398d, gma-MIR399i, gma-MIR167k, gma-MIR5770c, gma-MIR1446, gma-MIR167l, gma-MIR399j, gma-MIR399k, gma-MIR169w, gma-MIR399l, gma-MIR399m, gma-MIR399n, gma-MIR399o
On the other hand, the observed upregulation of miR390 as well as downregulation of miR171 in primary root tips (Table 2 and Additional file 2) is similar to what was observed in leaves of soybean exposed to drought [7]. [score:7]
Recently, several studies reported differential expression of miRNAs such as miR164, miR169, miR171, miR396, miR398, miR399, miR408 and miR2118 in drought-stressed plants but their regulation (up or down) differed between different plant species [5]. [score:4]
Among the highly conserved 23 miRNA families [23], two (miR156 and miR166) were classified as high, three (miR168, miR396 and miR172) as moderate and seven (miR169, miR171, miR164, miR390, miR159, miR160 and miR167) as low and two (miR395 and miR399) as extremely low abundantly expressed miRNA families in primary root tips of soybean. [score:3]
In response to N deprivation, down regulation of miR171 and miR398 [34] was reported, which is in agreement with our analysis under water stress. [score:2]
Nineteen miRNA families (miR5767, miR4345, miR169, miR2109, miR482, miR2119, miR2118, miR171, miR164, miR4413, miR390, miR1514, miR159, miR160, miR5781, miR167, miR5373 and miR4409) displayed lower abundances (1000 to 10,000 RPTM) (Additional file 2). [score:1]
[1 to 20 of 5 sentences]
3
[+] score: 11
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR319c, gma-MIR156b, gma-MIR169a, gma-MIR159b, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR171b, gma-MIR482a, gma-MIR1507a, gma-MIR1509a, gma-MIR1510a, gma-MIR1511, gma-MIR1512a, gma-MIR1516a, gma-MIR1520d, gma-MIR1520a, gma-MIR1520b, gma-MIR1520c, gma-MIR167d, gma-MIR396c, gma-MIR1507b, gma-MIR1510b, gma-MIR2119, gma-MIR167e, gma-MIR167f, gma-MIR1509b, gma-MIR1520e, gma-MIR1520f, gma-MIR1520g, gma-MIR4387c, gma-MIR1520h, gma-MIR1520i, gma-MIR396d, gma-MIR1520j, gma-MIR4365, gma-MIR4387b, gma-MIR482b, gma-MIR1520k, gma-MIR1520l, gma-MIR1520m, gma-MIR1520n, gma-MIR1520o, gma-MIR4387a, gma-MIR4387d, gma-MIR167g, gma-MIR1520r, gma-MIR156f, gma-MIR1520p, gma-MIR169d, gma-MIR1520q, gma-MIR171c, gma-MIR169e, gma-MIR4413a, gma-MIR156g, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR390c, gma-MIR398c, gma-MIR408d, gma-MIR2118a, gma-MIR2118b, gma-MIR482c, gma-MIR862a, gma-MIR1507c, gma-MIR4996, gma-MIR171h, gma-MIR171i, gma-MIR1516b, gma-MIR169h, gma-MIR167h, gma-MIR5039, gma-MIR169i, gma-MIR396f, gma-MIR5041, gma-MIR396g, gma-MIR167i, gma-MIR862b, gma-MIR5372, gma-MIR5374, gma-MIR5376, gma-MIR171j, gma-MIR397a, gma-MIR397b, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR3522, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR1512b, gma-MIR4413b, gma-MIR167j, gma-MIR171l, gma-MIR5668, gma-MIR5671a, gma-MIR1512c, gma-MIR4387e, gma-MIR393b, gma-MIR1516c, gma-MIR156p, gma-MIR171m, gma-MIR171n, gma-MIR156q, gma-MIR169o, gma-MIR319n, gma-MIR171p, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR482e, gma-MIR171r, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR171u, gma-MIR166m, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR1516d, gma-MIR398d, gma-MIR5671b, gma-MIR319o, gma-MIR319p, gma-MIR167k, gma-MIR319q, gma-MIR167l, gma-MIR169w
The targets prediction results of MIR1507, MIR390 and MIR171 were checked manually, gma-1507a and gma-1507b had the same target genes, while potential targets of gma-1507c were totally different. [score:7]
We also found that members of MIR390 and MIR171 had different expression pattern showed in Table S4. [score:3]
Members of MIR390 and MIR171 come to the same results. [score:1]
[1 to 20 of 3 sentences]
4
[+] score: 10
A total of 4 miRNA candidates had sequence homology with miR171, miR408, miR1171 and miR414, which have been shown to target genes coding for SCARECROW-like proteins implicated in radial root pattern [57], plantacyanin [58], copper chaperone [59] and translation initiation factor [60], respectively (Table 3). [score:5]
Read name Contig miRNA family MFE (kcal/mol) Target Ref E4UUDJH02I4UG8 contig25352 miR171 -37 SCARECROW-like protein Reinhart et al., 2002 E4UUDJH02HINHM contig16040 miR408 -29 plantacyanin Sunkar and Zhu, 2004 E4UUDJH01ECGTX contig11544 miR1171 -25 putative copper chaperone3 Molnar et al., 2007 E4UUDJH01AVSEX contig25342 miR414 -26 TIF3H1 Fattash et al., 2007 microRNA families and their target genes are also present in the table. [score:5]
[1 to 20 of 2 sentences]
5
[+] score: 8
Other miRNAs from this paper: mtr-MIR162, mtr-MIR166a, mtr-MIR169a, mtr-MIR399b, mtr-MIR399d, mtr-MIR395a, mtr-MIR395b, mtr-MIR399c, mtr-MIR399a, mtr-MIR399e, mtr-MIR319a, mtr-MIR156a, mtr-MIR171a, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR166a, gma-MIR166b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR398a, gma-MIR398b, gma-MIR319c, gma-MIR156b, gma-MIR169a, mtr-MIR395c, mtr-MIR395d, mtr-MIR395e, mtr-MIR395f, mtr-MIR395g, mtr-MIR395h, mtr-MIR395i, mtr-MIR395j, mtr-MIR395l, mtr-MIR395m, mtr-MIR395n, mtr-MIR395o, mtr-MIR395k, mtr-MIR156b, mtr-MIR164a, mtr-MIR166b, mtr-MIR169c, mtr-MIR169d, mtr-MIR169e, mtr-MIR171b, mtr-MIR166c, mtr-MIR166d, mtr-MIR169f, mtr-MIR156c, mtr-MIR156d, mtr-MIR390, mtr-MIR399f, mtr-MIR399g, mtr-MIR399h, mtr-MIR399i, mtr-MIR399j, mtr-MIR399k, mtr-MIR166e, mtr-MIR156e, mtr-MIR319b, mtr-MIR171c, mtr-MIR398a, mtr-MIR172a, mtr-MIR398b, mtr-MIR168a, mtr-MIR169g, mtr-MIR156f, mtr-MIR399l, mtr-MIR156g, mtr-MIR399m, mtr-MIR399n, mtr-MIR399o, mtr-MIR398c, mtr-MIR164b, mtr-MIR156h, mtr-MIR166f, mtr-MIR164c, mtr-MIR164d, mtr-MIR166g, mtr-MIR171d, mtr-MIR171e, mtr-MIR169h, mtr-MIR169b, mtr-MIR156i, mtr-MIR171f, mtr-MIR399p, gma-MIR162a, gma-MIR164a, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR390a, gma-MIR390b, gma-MIR171b, gma-MIR482a, gma-MIR1507a, gma-MIR1509a, gma-MIR1511, gma-MIR1512a, gma-MIR1515a, gma-MIR1521a, mtr-MIR1507, mtr-MIR1509a, gma-MIR1507b, gma-MIR2109, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR1509b, mtr-MIR2118, mtr-MIR169k, mtr-MIR2111c, mtr-MIR2111d, mtr-MIR2111e, mtr-MIR2111g, mtr-MIR2111h, mtr-MIR2111i, mtr-MIR2111m, mtr-MIR2111n, mtr-MIR2111o, mtr-MIR169j, mtr-MIR1509b, mtr-MIR2111b, mtr-MIR2111j, mtr-MIR2111k, mtr-MIR399q, mtr-MIR2678, lja-MIR2111, gma-MIR482b, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR156g, gma-MIR4416a, gma-MIR156h, gma-MIR156i, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR390c, gma-MIR398c, gma-MIR408d, gma-MIR2118a, gma-MIR2118b, gma-MIR482c, gma-MIR530a, gma-MIR862a, gma-MIR1507c, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR1521b, gma-MIR169i, mtr-MIR5204, mtr-MIR5213, mtr-MIR482, mtr-MIR2111l, mtr-MIR2111f, mtr-MIR172b, mtr-MIR172c, mtr-MIR171h, mtr-MIR168b, mtr-MIR399r, mtr-MIR156j, gma-MIR862b, gma-MIR403a, gma-MIR403b, gma-MIR171j, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR397a, gma-MIR397b, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR482d, gma-MIR1512b, gma-MIR171l, mtr-MIR168c, mtr-MIR408, mtr-MIR2111a, gma-MIR2111a, gma-MIR1512c, gma-MIR530b, mtr-MIR171g, mtr-MIR530, gma-MIR4416b, gma-MIR399a, gma-MIR828a, gma-MIR156p, gma-MIR530c, gma-MIR828b, gma-MIR530d, gma-MIR171m, gma-MIR172k, gma-MIR171n, gma-MIR156q, gma-MIR172l, gma-MIR169o, gma-MIR319n, gma-MIR171p, gma-MIR530e, gma-MIR169p, gma-MIR156r, gma-MIR399b, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR2111b, gma-MIR2111c, gma-MIR166k, gma-MIR2111d, gma-MIR156t, gma-MIR482e, gma-MIR399c, gma-MIR171r, gma-MIR399d, gma-MIR399e, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR2111e, gma-MIR2111f, gma-MIR171u, gma-MIR399f, gma-MIR399g, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, gma-MIR399h, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR1515b, lja-MIR171a, lja-MIR171b, lja-MIR171c, lja-MIR171d, lja-MIR172a, lja-MIR172b, lja-MIR172c, lja-MIR390a, lja-MIR390b, lja-MIR397, lja-MIR408, lja-MIR1507a, lja-MIR1507b, mtr-MIR169i, mtr-MIR172d, mtr-MIR319c, mtr-MIR319d, mtr-MIR397, mtr-MIR169l, mtr-MIR399s, mtr-MIR399t, gma-MIR398d, gma-MIR319o, gma-MIR319p, gma-MIR399i, gma-MIR319q, gma-MIR399j, gma-MIR399k, gma-MIR169w, gma-MIR399l, gma-MIR399m, gma-MIR399n, gma-MIR399o, lja-MIR164, lja-MIR398, lja-MIR168, lja-MIR395, lja-MIR1511, lja-MIR166
In both species, the specific miR171 isoforms studied were able to cleave the target transcript NSP2, a TF involved in NOD factor signaling. [score:3]
The common function of miR171 isoforms in nodulation and mycorrhization reinforces the idea that nodule development may have evolved from AM fungi interactions though a diversification and specialization process. [score:2]
More recently, a novel isoform of miR171 was discovered in M. truncatula and L. japonicus (Devers et al., 2011; Bazin et al., 2012; De Luis et al., 2012), that repress a key actor of symbiotic signaling, NSP2 (Nodulation Signaling Pathway 2, a GRAS TF). [score:1]
Finally, the role of miR171 in legumes, first suggested by Devers et al. (2011), emerged through three different reports. [score:1]
Further analyses of the miR171 family using both miRBase and comparative genomics (Bazin et al., 2012) revealed that this isoform is also present in non-legume species, such as Populus trichocarpa (ptc-miR171) and Citrus sinensis (csi-miR171b). [score:1]
[1 to 20 of 5 sentences]
6
[+] score: 8
Other miRNAs from this paper: gma-MIR166a, gma-MIR166b, gma-MIR172a, gma-MIR172b, gma-MIR319a, gma-MIR319b, gma-MIR319c, gma-MIR169a, gma-MIR159b, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR171b, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR169i, gma-MIR171j, gma-MIR397a, gma-MIR397b, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR171l, gma-MIR2111a, gma-MIR399a, gma-MIR171m, gma-MIR172k, gma-MIR171n, gma-MIR172l, gma-MIR169o, gma-MIR319n, gma-MIR171p, gma-MIR169p, gma-MIR399b, gma-MIR171q, gma-MIR169r, gma-MIR169s, gma-MIR2111b, gma-MIR2111c, gma-MIR166k, gma-MIR2111d, gma-MIR399c, gma-MIR171r, gma-MIR399d, gma-MIR399e, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR2111e, gma-MIR2111f, gma-MIR171u, gma-MIR399f, gma-MIR399g, gma-MIR166m, gma-MIR169u, gma-MIR399h, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR319o, gma-MIR319p, gma-MIR399i, gma-MIR319q, gma-MIR399j, gma-MIR399k, gma-MIR169w, gma-MIR399l, gma-MIR399m, gma-MIR399n, gma-MIR399o
For example, Lotus miR171 and miR397 modulate rhizobial infection by targeting a transcription factor gene, Nodulation Signaling Pathway 2, and a gene encoding a laccase copper protein, respectively [53, 56]. [score:3]
Among the eleven cold-responsive miRNAs we identified, four (miR166, miR171, miR2111 and miR169) are highly conserved in higher plants, and these miRNAs have been shown to regulate plant cold responses [8, 10, 11, 48, 49]. [score:2]
Thus, multiple miRNAs, including miR166, miR171, miR2111 and miR397, are required for nodule development, nitrogenase activity and nitrogen fixation efficiency control in nodules and in the adaptation of plants to adverse environmental conditions. [score:2]
Notably, previous studies have shown that miR166, miR171, miR2111 and miR397 are involved in nodulation in the legumes, Medicago and Lotus [52, 53, 54, 55]. [score:1]
[1 to 20 of 4 sentences]
7
[+] score: 7
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR160a, gma-MIR168a, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR319c, gma-MIR156b, gma-MIR169a, gma-MIR164a, gma-MIR167c, gma-MIR171a, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR171b, gma-MIR482a, gma-MIR1507a, gma-MIR1510a, gma-MIR1507b, gma-MIR1510b, gma-MIR2109, gma-MIR172c, gma-MIR482b, gma-MIR156f, gma-MIR171c, gma-MIR394b, gma-MIR156g, gma-MIR394a, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR168b, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR390c, gma-MIR394c, gma-MIR398c, gma-MIR408d, gma-MIR2118a, gma-MIR2118b, gma-MIR482c, gma-MIR1507c, gma-MIR171h, gma-MIR171i, gma-MIR862b, gma-MIR5037c, gma-MIR171j, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR166i, gma-MIR171k, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR482d, gma-MIR171l, gma-MIR5770a, gma-MIR393b, gma-MIR156p, gma-MIR171m, gma-MIR171n, gma-MIR156q, gma-MIR319n, gma-MIR171p, gma-MIR394d, gma-MIR156r, gma-MIR171q, gma-MIR156s, gma-MIR156t, gma-MIR482e, gma-MIR171r, gma-MIR394e, gma-MIR171s, gma-MIR171t, gma-MIR394f, gma-MIR171u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR394g, gma-MIR319o, gma-MIR319p, gma-MIR319q
Infection by any of the three SMV isolates upregulated members of both miR171 (miR171c/j-5p) and miR156 families (miR156t-5p) (Fig 3). [score:4]
In Arabidopsis, miR171 is induced by Turnip mosaic virus (TuMV) infection and directs cleavage of several mRNAs coding for Scarecrow-like transcription factors [36]. [score:2]
These included miRNAs-3p members of four miRNA families, i. e., miR160 (miR160a), miR171 (miR171b and miR171i), miR394 (miR394a and miR394b) and miR408 (miR408a and miR408c) (S2 Table and Fig 4A). [score:1]
[1 to 20 of 3 sentences]
8
[+] score: 5
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR396e, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR172a, gma-MIR172b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR156b, gma-MIR169a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR171b, gma-MIR482a, sly-MIR160a, sly-MIR166a, sly-MIR166b, sly-MIR167a, sly-MIR169a, sly-MIR169b, sly-MIR169c, sly-MIR169d, sly-MIR171a, sly-MIR171b, sly-MIR171c, sly-MIR171d, sly-MIR395a, sly-MIR395b, sly-MIR156a, sly-MIR156b, sly-MIR156c, sly-MIR159, sly-MIR162, sly-MIR172a, sly-MIR172b, osa-MIR396f, gma-MIR167d, gma-MIR396c, mdm-MIR482a, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR394b, gma-MIR156g, gma-MIR159d, gma-MIR394a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR394c, gma-MIR408d, gma-MIR482c, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, sly-MIR482e, sly-MIR482a, gma-MIR171j, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR167j, gma-MIR171l, gma-MIR156p, gma-MIR171m, gma-MIR172k, gma-MIR171n, gma-MIR156q, gma-MIR172l, gma-MIR169o, gma-MIR171p, gma-MIR394d, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR482e, gma-MIR171r, gma-MIR394e, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR394f, gma-MIR171u, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, sly-MIR482b, sly-MIR482c, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR394g, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, mdm-MIR156a, mdm-MIR156b, mdm-MIR156c, mdm-MIR156d, mdm-MIR156e, mdm-MIR156f, mdm-MIR156g, mdm-MIR156h, mdm-MIR156i, mdm-MIR156j, mdm-MIR156k, mdm-MIR156l, mdm-MIR156m, mdm-MIR156n, mdm-MIR156o, mdm-MIR156p, mdm-MIR156q, mdm-MIR156r, mdm-MIR156s, mdm-MIR156t, mdm-MIR156u, mdm-MIR156v, mdm-MIR156w, mdm-MIR156x, mdm-MIR156y, mdm-MIR156z, mdm-MIR156aa, mdm-MIR156ab, mdm-MIR156ac, mdm-MIR156ad, mdm-MIR156ae, mdm-MIR159a, mdm-MIR159b, mdm-MIR160a, mdm-MIR160b, mdm-MIR160c, mdm-MIR160d, mdm-MIR160e, mdm-MIR162a, mdm-MIR162b, mdm-MIR164a, mdm-MIR164b, mdm-MIR164c, mdm-MIR164d, mdm-MIR164e, mdm-MIR164f, mdm-MIR166a, mdm-MIR166b, mdm-MIR166c, mdm-MIR166d, mdm-MIR166e, mdm-MIR166f, mdm-MIR166g, mdm-MIR166h, mdm-MIR166i, mdm-MIR167a, mdm-MIR167b, mdm-MIR167c, mdm-MIR167d, mdm-MIR167e, mdm-MIR167f, mdm-MIR167g, mdm-MIR167h, mdm-MIR167i, mdm-MIR167j, mdm-MIR169a, mdm-MIR169b, mdm-MIR169c, mdm-MIR169d, mdm-MIR171a, mdm-MIR171b, mdm-MIR171c, mdm-MIR171d, mdm-MIR171e, mdm-MIR171f, mdm-MIR171g, mdm-MIR171h, mdm-MIR171i, mdm-MIR171j, mdm-MIR171k, mdm-MIR171l, mdm-MIR171m, mdm-MIR171n, mdm-MIR172a, mdm-MIR172b, mdm-MIR172c, mdm-MIR172d, mdm-MIR172e, mdm-MIR172f, mdm-MIR172g, mdm-MIR172h, mdm-MIR172i, mdm-MIR172j, mdm-MIR172k, mdm-MIR172l, mdm-MIR172m, mdm-MIR172n, mdm-MIR172o, mdm-MIR394a, mdm-MIR394b, mdm-MIR395a, mdm-MIR395b, mdm-MIR395c, mdm-MIR395d, mdm-MIR395e, mdm-MIR395f, mdm-MIR395g, mdm-MIR395h, mdm-MIR395i, mdm-MIR396a, mdm-MIR396b, mdm-MIR396c, mdm-MIR396d, mdm-MIR396e, mdm-MIR396f, mdm-MIR396g, mdm-MIR408a, mdm-MIR482b, mdm-MIR482c, mdm-MIR408b, mdm-MIR408c, mdm-MIR408d, mdm-MIR482d, mdm-MIR159c, mdm-MIR171o, mdm-MIR169e, mdm-MIR169f, sly-MIR164a, sly-MIR164b, sly-MIR394, sly-MIR166c, sly-MIR156d, sly-MIR156e, sly-MIR396a, sly-MIR167b, sly-MIR482d, sly-MIR169e, sly-MIR396b, sly-MIR171e, gma-MIR167k, gma-MIR167l, gma-MIR169w, sly-MIR172c, sly-MIR408, sly-MIR172d, sly-MIR169f, sly-MIR171f, mdm-MIR159d, mdm-MIR159e, mdm-MIR159f, mdm-MIR166j, mdm-MIR395j, mdm-MIR169g, mdm-MIR169h, mdm-MIR169i, mdm-MIR169j, mdm-MIR171p, mdm-MIR395k, mdm-MIR171q, mdm-MIR169k, mdm-MIR169l, mdm-MIR169m, mdm-MIR169n, mdm-MIR172p, mdm-MIR395l, mdm-MIR169o
However, target genes for miR167 were detected only in predicted gene mo dels, and miR171 had predicted target genes only in mesocarp cDNA sequences. [score:5]
[1 to 20 of 1 sentences]
9
[+] score: 3
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR169a, ath-MIR171a, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR171b, ath-MIR171c, ath-MIR395a, ath-MIR395b, ath-MIR395c, ath-MIR395d, ath-MIR395e, ath-MIR395f, ath-MIR396a, ath-MIR396b, ath-MIR399a, ath-MIR408, ath-MIR156g, ath-MIR156h, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR166a, gma-MIR166b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR156b, gma-MIR169a, ath-MIR848, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR171b, gma-MIR1527, gma-MIR1533, gma-MIR396c, pvu-MIR166a, pvu-MIR399a, gma-MIR396d, gma-MIR156f, gma-MIR169d, gma-MIR171c, gma-MIR169e, gma-MIR156g, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR408d, ath-MIR5021, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR171j, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR396h, gma-MIR396i, gma-MIR171l, ath-MIR156i, ath-MIR156j, gma-MIR399a, gma-MIR156p, gma-MIR171m, gma-MIR171n, gma-MIR156q, gma-MIR169o, gma-MIR171p, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR171r, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR171u, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR169w
Scarecrow-like transcription factor is already an established target for miR171 family in Arabidopsis [69] and Oryza sativa [70]. [score:3]
[1 to 20 of 1 sentences]
10
[+] score: 3
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR390, osa-MIR396e, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR319c, gma-MIR156b, gma-MIR169a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR171b, gma-MIR482a, gma-MIR1507a, gma-MIR1508a, gma-MIR1509a, gma-MIR1510a, gma-MIR1511, gma-MIR1512a, gma-MIR1515a, osa-MIR827, osa-MIR396f, gma-MIR167d, gma-MIR396c, gma-MIR1507b, gma-MIR1510b, gma-MIR2109, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR1509b, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR156g, gma-MIR159d, gma-MIR4416a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR390c, gma-MIR398c, gma-MIR408d, gma-MIR2118a, gma-MIR2118b, gma-MIR482c, gma-MIR1507c, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR171j, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR397a, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR1512b, gma-MIR167j, gma-MIR171l, gma-MIR2111a, gma-MIR1512c, gma-MIR393b, gma-MIR399a, gma-MIR156p, gma-MIR171m, gma-MIR172k, gma-MIR171n, gma-MIR156q, gma-MIR172l, gma-MIR169o, gma-MIR319n, gma-MIR171p, gma-MIR169p, gma-MIR156r, gma-MIR399b, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR2111b, gma-MIR2111c, gma-MIR166k, gma-MIR2111d, gma-MIR156t, gma-MIR482e, gma-MIR399c, gma-MIR171r, gma-MIR399d, gma-MIR399e, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR2111e, gma-MIR2111f, gma-MIR171u, gma-MIR399f, gma-MIR399g, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, gma-MIR399h, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR1515b, gma-MIR398d, gma-MIR319o, gma-MIR319p, gma-MIR399i, gma-MIR167k, gma-MIR319q, gma-MIR167l, gma-MIR399j, gma-MIR399k, gma-MIR169w, gma-MIR399l, gma-MIR399m, gma-MIR399n, gma-MIR399o
It was reported that five conserved miRNAs (miR159, miR162, miR166, miR390, and miR399) presented similar expression levels in root apexes and nodules, but miR169, miR171, miR393, and miR396 enriched in root tips [41]. [score:3]
[1 to 20 of 1 sentences]
11
[+] score: 3
Other miRNAs from this paper: gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR319a, gma-MIR319b, gma-MIR396a, gma-MIR396b, gma-MIR319c, gma-MIR169a, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR171b, gma-MIR482a, gma-MIR1507a, gma-MIR1509a, gma-MIR1510a, gma-MIR167d, gma-MIR396c, gma-MIR1507b, gma-MIR1510b, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR1509b, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR159d, gma-MIR396e, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR482c, gma-MIR1507c, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR171j, gma-MIR397a, gma-MIR397b, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR167j, gma-MIR171l, gma-MIR393b, gma-MIR171m, gma-MIR172k, gma-MIR171n, gma-MIR172l, gma-MIR169o, gma-MIR319n, gma-MIR171p, gma-MIR169p, gma-MIR396j, gma-MIR171q, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR482e, gma-MIR171r, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR171u, gma-MIR166m, gma-MIR169u, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR319o, gma-MIR319p, gma-MIR167k, gma-MIR319q, gma-MIR167l, gma-MIR169w
UUGAGCCGCGCCAAUAUCACU 21 H gma-MIR171? [score:1]
UGAAGCUGCCAGCAUGAUCUU 21 H 168 gma-MIR168 UCGCUUGGUGCAGGUCGGGAA 21 H, N (21 nt) 169 gma-MIR169 CAGCCAAGGAUGACUUGCCGG 21 H, P, N (21 nt) gma-MIR169b CAGCCAAGGAUGACUUGCCGA 21 H, P gma-MIR169c AAGCCAAGGAUGACUUGCCGA 21 H, P 171 gma-MIR171a UUGAGCCGUGCCAAUAUCACG 21 H, P gma-MIR171? [score:1]
UUGAGCCGCGUCAAUAUCUCA 21 H gma-MIR171? [score:1]
[1 to 20 of 3 sentences]
12
[+] score: 3
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR156b, gma-MIR169a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR393a, gma-MIR171b, gma-MIR1515a, gma-MIR167d, gma-MIR396c, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR396d, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR394b, gma-MIR156g, gma-MIR394a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR394c, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR171j, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR396h, gma-MIR396i, gma-MIR167j, gma-MIR171l, gma-MIR393b, gma-MIR156p, gma-MIR171m, gma-MIR172k, gma-MIR171n, gma-MIR156q, gma-MIR172l, gma-MIR169o, gma-MIR171p, gma-MIR394d, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR156t, gma-MIR171r, gma-MIR394e, gma-MIR169t, gma-MIR171s, gma-MIR171t, gma-MIR394f, gma-MIR171u, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR169v, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR394g, gma-MIR167k, gma-MIR167l, gma-MIR169w
These miRNAs including miR156, miR158, miR165, miR167, miR168, miR169, miR171, miR393, miR394 and miR396 were responsive to salt stress and may fine-tune plant stress responses at multiple levels through targeting the genes with different functions including large sets of genes that encode various transcription factors [15, 19, 20]. [score:3]
[1 to 20 of 1 sentences]
13
[+] score: 2
Other miRNAs from this paper: gma-MIR159a, gma-MIR166a, gma-MIR166b, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR169a, gma-MIR159b, gma-MIR159c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR393a, gma-MIR171b, gma-MIR482a, gma-MIR1507a, gma-MIR1509a, gma-MIR1510a, gma-MIR1512a, gma-MIR1518, gma-MIR396c, gma-MIR1507b, gma-MIR1510b, gma-MIR2109, gma-MIR2119, gma-MIR1509b, gma-MIR396d, gma-MIR482b, gma-MIR169d, gma-MIR171c, gma-MIR169e, gma-MIR159d, gma-MIR396e, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR398c, gma-MIR408d, gma-MIR2118a, gma-MIR2118b, gma-MIR482c, gma-MIR1507c, gma-MIR4996, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR5037c, gma-MIR171j, gma-MIR397a, gma-MIR397b, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR3522, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR1512b, gma-MIR171l, gma-MIR1512c, gma-MIR393b, gma-MIR399a, gma-MIR171m, gma-MIR171n, gma-MIR169o, gma-MIR171p, gma-MIR169p, gma-MIR399b, gma-MIR396j, gma-MIR171q, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR482e, gma-MIR399c, gma-MIR171r, gma-MIR399d, gma-MIR399e, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR171u, gma-MIR399f, gma-MIR399g, gma-MIR166m, gma-MIR169u, gma-MIR399h, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR398d, gma-MIR9727, gma-MIR9750, gma-MIR399i, gma-MIR399j, gma-MIR399k, gma-MIR169w, gma-MIR399l, gma-MIR399m, gma-MIR399n, gma-MIR399o
Furthermore, miR169 and miR171, which are involved in powdery mildew infection in wheat [49], were also significantly induced by SCN in both susceptible and resistant cultivars (Additional file 2: Table S2). [score:1]
According to the functional analysis and previous reports, several conserved miRNAs (for example, gma-miR159, gma-miR171, gma-miR398, gma-miR399, and gma-miR408) and legume specific miRNAs (for example, gma-miR1512, gma-miR2119, and gma-miR9750) could be potential candidates for manipulating the SCN infection. [score:1]
[1 to 20 of 2 sentences]
14
[+] score: 2
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR319c, gma-MIR156b, gma-MIR164a, gma-MIR167c, gma-MIR171a, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR171b, gma-MIR167d, gma-MIR396c, gma-MIR167e, gma-MIR167f, gma-MIR1509b, gma-MIR396d, gma-MIR167g, gma-MIR156f, gma-MIR4403, gma-MIR171c, gma-MIR156g, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR390c, gma-MIR398c, gma-MIR408d, gma-MIR1535b, gma-MIR4996, gma-MIR171h, gma-MIR171i, gma-MIR167h, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR5037b, gma-MIR171j, gma-MIR397a, gma-MIR397b, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR3522, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR166i, gma-MIR166j, gma-MIR169m, gma-MIR171k, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR396h, gma-MIR396i, gma-MIR167j, gma-MIR171l, gma-MIR393b, gma-MIR156p, gma-MIR171m, gma-MIR171n, gma-MIR156q, gma-MIR319n, gma-MIR171p, gma-MIR156r, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR171r, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR171u, gma-MIR166m, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR6300, gma-MIR398d, gma-MIR319o, gma-MIR319p, gma-MIR167k, gma-MIR319q, gma-MIR167l
For instance, miR393 and miR171 respond to heavy metals in Brassica (B. napus) [21], [22] and Medicago (M. truncatula) [23]. [score:1]
Ding et al. [25] verified that miR166, miR171, miR390, miR156 and miR168 responded to Cd stress in rice, and Zhou et al. [26] reported that miR396, miR397, miR398 and miR408 were related to Cd exposure in Brassica. [score:1]
[1 to 20 of 2 sentences]
15
[+] score: 1
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR319c, gma-MIR156b, gma-MIR169a, gma-MIR159b, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR390a, gma-MIR171b, gma-MIR482a, gma-MIR1507a, gma-MIR1510a, gma-MIR1511, gma-MIR1512a, gma-MIR1520d, gma-MIR167d, gma-MIR2109, gma-MIR2119, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR4348a, gma-MIR4361, gma-MIR4368b, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR394b, gma-MIR4413a, gma-MIR156g, gma-MIR159d, gma-MIR394a, gma-MIR4414a, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR171e, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR390c, gma-MIR398c, gma-MIR408d, gma-MIR2118a, gma-MIR862a, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR167i, gma-MIR5372, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR397a, gma-MIR397b, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR3522, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR166i, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR1512b, gma-MIR167j, gma-MIR1512c, gma-MIR5559, gma-MIR5774b, gma-MIR399a, gma-MIR156p, gma-MIR172k, gma-MIR171n, gma-MIR156q, gma-MIR172l, gma-MIR169o, gma-MIR319n, gma-MIR169p, gma-MIR156r, gma-MIR399b, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR5786, gma-MIR156t, gma-MIR2606a, gma-MIR399c, gma-MIR399d, gma-MIR399e, gma-MIR169t, gma-MIR399f, gma-MIR399g, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR169u, gma-MIR399h, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166u, gma-MIR169v, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR398d, gma-MIR4348b, gma-MIR319o, gma-MIR319p, gma-MIR399i, gma-MIR167k, gma-MIR4348c, gma-MIR319q, gma-MIR4348d, gma-MIR167l, gma-MIR399j, gma-MIR399k, gma-MIR169w, gma-MIR399l, gma-MIR399m, gma-MIR4414b, gma-MIR399n, gma-MIR399o
The x-axis indicates twelve selected miRNAs, which are respectively as follows: 1. gma-miR1511-3p; 2. gma-miR390a/c-3p; 3. gma-miR396b/c/d/f/g-5p; 4. gma-miR396b/d/g-3p; 5. gma-miR398a/b-3p; 6. gma-miR4348-5p; 7. gma-miR4413a-5p; 8. gma-miR482a-3p; 9. gma-miR156p-5p; 10. gma-miR171n-3p; 11. gma-miR171o-5p; 12. gma-miR172l-3p. [score:1]
[1 to 20 of 1 sentences]
16
[+] score: 1
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR156b, gma-MIR169a, gma-MIR159b, gma-MIR159c, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR171b, gma-MIR1507a, gma-MIR1508a, gma-MIR1509a, gma-MIR1510a, gma-MIR1523a, gma-MIR1528, gma-MIR1535a, gma-MIR167d, gma-MIR396c, gma-MIR1507b, gma-MIR1508b, gma-MIR1510b, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR1509b, gma-MIR396d, gma-MIR4366, gma-MIR4382, gma-MIR4389, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR4411, gma-MIR171c, gma-MIR169e, gma-MIR4412, gma-MIR4413a, gma-MIR156g, gma-MIR159d, gma-MIR4416a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR408d, gma-MIR1507c, gma-MIR1508c, gma-MIR1535b, gma-MIR4996, gma-MIR1523b, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR5374, gma-MIR171j, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR397a, gma-MIR397b, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR3522, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR396h, gma-MIR396i, gma-MIR4413b, gma-MIR167j, gma-MIR171l, gma-MIR5667, gma-MIR5761a, gma-MIR4416c, gma-MIR5761b, gma-MIR4416b, gma-MIR156p, gma-MIR171m, gma-MIR171n, gma-MIR156q, gma-MIR169o, gma-MIR171p, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR171r, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR171u, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR167k, gma-MIR167l, gma-MIR169w
MiR156, miR164 and miR171 were found to be significantly responsive to chilling stress in accord with those in S. habrochaites and Cassava 35 45. [score:1]
[1 to 20 of 1 sentences]