sort by

2 publications mentioning mtr-MIR159b

Open access articles that are associated with the species Medicago truncatula and mention the gene name MIR159b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 63
Other miRNAs from this paper: mtr-MIR319a, mtr-MIR319b, mtr-MIR159a, mtr-MIR319c, mtr-MIR319d
miR159b represents a suitable backbone for artificial microRNA (amiR) expression in M. truncatulaExpression of artificial miRNAs requires a miRNA backbone sequence, of which the mature miRNA is replaced by an artificial miRNA (amiR), which binds and cleaves its target sequence(s). [score:7]
The miR159b backbone driven amiR constructs lead to efficient knock-down in M. truncatula rootsNext, we tested the functionality of miR159b -mediated amiR expression in roots of M. truncatula. [score:4]
The endogenous microRNA (miR) mtr-miR159b was selected as a backbone molecule for driving amiR expression. [score:3]
Here we demonstrate that mtr-miR159b is effectively processed from its precursor molecule and thus represents a highly suitable backbone for the expression of amiRs in M. truncatula. [score:3]
miR159b represents a suitable backbone for artificial microRNA (amiR) expression in M. truncatula. [score:3]
Click here for file Sequence of the mtr-miR159b backbone for amiRNA expression in pBluescriptII SK+ vector. [score:3]
Constructs were generated using an overlapping PCR strategy as recently described [12], where the mature miR159b sequence was replaced by sequences complementary to a selected region of the target gene. [score:3]
Figure 1 mtr-miR159b represents a suitable backbone for amiR expression in M. truncatula. [score:3]
We expected a loss of dsRED expression in roots after transformation with amiR- dsred construct, which would indicate that the miR159b backbone -driven amiR system works in M. truncatula roots. [score:3]
In a first attempt to test the mtr-miR159b -mediated amiR expression, we introduced 35S [pro]::amiR- dsred constructs by agroinfiltration in tobacco (Nicotiana benthamiana). [score:3]
To test the functionality of the mtr-miR159b backbone system, we first generated amiRs targeting dsRED and tested them in a heterologous system using dsRED fluorescence as visible marker for gene silencing. [score:3]
Sequence of the mtr-miR159b backbone for amiRNA expression in pBluescriptII SK+ vector. [score:3]
The miR159b -mediated amiR expression mediates strong silencing in tobacco leaves. [score:3]
Heterologous expression of mtr-miR159b-amiR constructs in tobacco showed that the backbone is functional and mediates an efficient gene silencing. [score:3]
Next, we tested the functionality of miR159b -mediated amiR expression in roots of M. truncatula. [score:3]
The miR159b backbone driven amiR constructs lead to efficient knock-down in M. truncatula roots. [score:2]
The miR159b primary transcript sequence was cloned in the pBluescript II SK+ vector flanked by restriction sites, which allow a directed cloning of the amiR sequences in the appropriate binary vectors for plant transformation (Additional file 1: Figure S1. ) [score:2]
The distribution of degradome tags across the miR159b precursor sequence confirmed the loop to base processing for this miR159 family member in M. truncatula. [score:1]
Overlapping PCR using the miR159b backbone to design an artificial miRNA. [score:1]
Figure 2 The mt-miR159b -mediated amiR-silencing is efficient in tobacco leaves. [score:1]
All M. truncatula precursor sequences belonging to the families of miR159 and miR319, were gathered and analyzed for small RNA and degradome read location as well as abundance. [score:1]
The mature miR159b is labeled in red, the miR159b* is labeled in purple. [score:1]
The miR159b backbone was synthesized by gene synthesis (MWG) and an additional MluI site was added to the 3′ end of the miR precursor. [score:1]
The novel star sequence was designed in a way that the secondary structures of the miR159b backbone were conserved. [score:1]
The read numbers of miR159 and miR159* from the small RNA libraries [23] are given. [score:1]
For this purpose, we screened our recent miRNA and degradome data of M. truncatula roots [23] for amiR backbone sequences and selected mtr-miR159b as a suitable precursor (Figure  1) since it showed all the necessary features mentioned above. [score:1]
[1 to 20 of 26 sentences]
2
[+] score: 10
Other miRNAs from this paper: dme-mir-7, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-34a, hsa-mir-124-1, hsa-mir-124-2, mmu-mir-34a, osa-MIR169a, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, cel-mir-354, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR168a, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, mtr-MIR169a, mtr-MIR319a, ptc-MIR159a, ptc-MIR159b, ptc-MIR159d, ptc-MIR159e, ptc-MIR159c, ptc-MIR168a, ptc-MIR169a, ptc-MIR169aa, ptc-MIR169ab, ptc-MIR169ac, ptc-MIR169ad, ptc-MIR169ae, ptc-MIR169af, ptc-MIR169b, ptc-MIR169c, ptc-MIR169d, ptc-MIR169e, ptc-MIR169f, ptc-MIR169g, ptc-MIR169h, ptc-MIR169i, ptc-MIR169j, ptc-MIR169k, ptc-MIR169l, ptc-MIR169m, ptc-MIR169n, ptc-MIR169o, ptc-MIR169p, ptc-MIR169q, ptc-MIR169r, ptc-MIR169s, ptc-MIR169t, ptc-MIR169u, ptc-MIR169v, ptc-MIR169w, ptc-MIR169x, ptc-MIR169y, ptc-MIR169z, ptc-MIR319a, ptc-MIR319b, ptc-MIR319c, ptc-MIR319d, ptc-MIR319e, ptc-MIR319f, ptc-MIR319g, ptc-MIR319h, ptc-MIR319i, hsa-mir-519b, ppt-MIR319a, ppt-MIR319b, ppt-MIR319c, ppt-MIR319d, mtr-MIR169c, mtr-MIR169d, mtr-MIR169e, mtr-MIR169f, mtr-MIR319b, mtr-MIR168a, mtr-MIR169g, mtr-MIR169h, mtr-MIR169b, ppt-MIR319e, osa-MIR169r, mtr-MIR159a, mtr-MIR169k, mtr-MIR169j, ptc-MIR169ag, mtr-MIR169i, mtr-MIR319c, mtr-MIR319d, mtr-MIR169l
miR159 and miR319 belong to the same MIR family based on their evolutionary origin [30, 44], playing important roles in plant development [47]. [score:2]
Importantly, a close inspection showed that many individual miRNA-like RNAs on the miR159 and miR319 precursors are also highly conserved at the sequence level. [score:1]
miRNA-like RNAs appeared in miR319 precursors in all of these five plants, and miRNA-like RNAs occurred in miR159 precursors in all of five bar moss. [score:1]
This is consistent with the recent discovery that the DCL cleavage that produces mature miR159 and miR319 starts from the loop ends of their fold-back structures [45, 46]. [score:1]
Some of these miRNA-like RNAs from conserved miRNA families, that is, miR159 and miR319 in plants, are conserved at the sequence level (Figure 7), which adds another layer of evidence that these miRNA-like RNAs are potentially functionally important in plants. [score:1]
1* TTTGGATTGAAGGGAGCTCTA 6,587 miR519b + miR159b. [score:1]
2* ATGCCATATCTCAGGAGCTTT 14 1,2,7 miR159b. [score:1]
Note that miRNA-miRNA* duplexes for miRNA-like RNAs, with approximately two-nucleotide 3'-end overhangs, appear on the miR159, miR169m and miR319b precursors. [score:1]
In the five plant species we studied, miRNA-like RNAs appeared in two well-conserved miRNA families, that is, miR159 and miR319 (Table 2). [score:1]
[1 to 20 of 9 sentences]