sort by

12 publications mentioning ssc-mir-486-2

Open access articles that are associated with the species Sus scrofa and mention the gene name mir-486-2. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 35
of differentially expressed porcine miRNAsTarget genes for the eight differentially expressed miRNAs (Hsa-miR-200b-3p, Hsa-miR-200c-3p, Ssc-miR-126, Ssc-miR-126 [*], Ssc-miR-99a, Bta-miR-193b, Ssc-miR-486 and Ssc-let-7f) were predicted in silico. [score:7]
Target genes for the eight differentially expressed miRNAs (Hsa-miR-200b-3p, Hsa-miR-200c-3p, Ssc-miR-126, Ssc-miR-126 [*], Ssc-miR-99a, Bta-miR-193b, Ssc-miR-486 and Ssc-let-7f) were predicted in silico. [score:5]
According to sequence count, nine miRNAs highly expressed (Hsa-miR-200b-3p, Hsa-miR-200c-3p, Ssc-miR-126, Ssc-miR-126*, Ssc-miR-99a, Ssc-miR-532-5p, Ssc-miR-92a, Ssc-miR-26a and Bta-miR-193b, n>100) and four miRNAs lowly expressed (Ssc-miR-423-5p, Ssc-miR-29c, Ssc-miR-486 and Ssc-let-7f, n<100) in the kidney miRNAome were selected to measure their expression levels by RT-qPCR. [score:5]
Ssc-miR-99a, Bta-miR-193b and Ssc-miR-423-5p were selected to be up regulated in EU, Hsa-miR-200b-3p, Ssc-miR-532-5p and Ssc-let-7f to be up regulated in AS and, Hsa-miR-200c-3p, Ssc-miR-92a, Ssc-miR-26a, Ssc-miR-486 and Ssc-miR-29c to be up regulated in EA. [score:4]
No significant related pathways were obtained from targets associated to Bta-miR-193b and Ssc-miR-486. [score:3]
Significant differential expression regarding breed groups was obtained by RT-qPCR in eight miRNAs: Hsa-miR-200b-3p, Hsa-miR-200c-3p, Ssc-miR-126, Ssc-miR-126*, Ssc-miR-99a, Bta-miR-193b, Ssc-miR-486 and Ssc-let-7f. [score:3]
Eight miRNAs (Hsa-miR-200b-3p, Hsa-miR-200c-3p, Ssc-miR-126, Ssc-miR-126*, Ssc-miR-99a, Bta-miR-193b, Ssc-miR-486 and Ssc-let-7f) were differentially expressed in at least one comparison by RT-qPCR (p-value<0.05) (Table 6). [score:3]
Additionally, looking at normalised counts for each breed (Table S6), there were some miRNAs with low frequency which their expression was higher in some breed, such as Hsa-miR-193b-5p, Hsa-miR-140-5p, Ssc-miR-19b, Ssc-miR-423-5p and Ssc-miR-24 in Iberian breed, Ssc-miR-151-5p, Hsa-miR-4454, Ssc-miR-199a-3p and Ssc-miR-374b-5p in Landrace breed, Ssc-miR-486 in Piétrain breed and Ssc-let-7f and Hsa-let-7i-5p in Meishan breed. [score:3]
On the other hand, Hsa-miR-200c-3p and Ssc-miR-486 were down and up regulated in EA, respectively. [score:2]
[1 to 20 of 9 sentences]
2
[+] score: 10
Hitachi et [43] reported that the expression level of miR-486 in skeletal muscle was significantly increased, and showed that, miR-486, which is a positive regulator of the IGF-1/Akt pathway, is involved in myostatin signaling in myostatin knockout mice. [score:5]
We have identified several miRNAs that are up-regulated in MSTN [-/-] pigs, and these miRNAs have previously been shown to be involved in myoblast development, including the well-known miR-1, miR-206 [13, 15], and miR-486 [26] (Figure 1A). [score:5]
[1 to 20 of 2 sentences]
3
[+] score: 7
In addition, 10 other miRNAs (miR-378-1/-2-3p, miR-127-3p, miR-191-5p, miR-486-2-5p, miR-143-3p, miR-10a-5p, miR-148a-3p, miR-99a-5p, miR-30e-5p, and miR-199a-1/-2-5p) (Fig. 2) in the set of the top 10 most highly expressed unique miRNAs over the five muscle development stages are related to various cell proliferation, myogenesis, and apoptosis responses. [score:4]
miR-486 is directly controlled by SRF, myocardin-related transcription factor-A (MRTF-A), and MyoD, and regulates muscle growth and homeostasis (Small et al., 2010). [score:3]
[1 to 20 of 2 sentences]
4
[+] score: 5
Small E. M. O’Rourke J. R. Moresi V. Sutherland L. B. McAnally J. Gerard R. D. Richardson J. A. Olson E. N. Regulation of PI3-kinase/Akt signaling by muscle-enriched microRNA-486 Proc. [score:2]
The top nine most abundant miRNAs shared between the two groups were ssc-miR-10b, ssc-miR-22-3p, ssc-miR-486, ssc-miR-26a, ssc-miR-27b-3p, ssc-miR-191, ssc-miR-378, ssc-126-5p and ssc-miR-181. [score:1]
In our sequencing libraries, five of these known myomiRs (miR-486, miR-26a, miR-27b, miR-378 and miR-181) were identified with the greatest abundance, accounting for 26% and 29% of the total normalized miRNA reads in the LPS-challenged and saline -treated groups, respectively. [score:1]
Previous studies have demonstrated that the myomiRs miR-1, miR-133a/b, miR-206, miR-486, miR-26a, miR-27b, miR-378, miR-148a and miR-181 are highly enriched in skeletal muscle and play a key role in skeletal muscle metabolism [28, 29, 30, 31]. [score:1]
[1 to 20 of 4 sentences]
5
[+] score: 4
Many miRNAs, such as miR-1, miR-133, miR-29, miR-214, miR-206, miR-486, miR-208b, and miR-499 were involved in the regulation of skeletal myogenesis by binding to its target genes 36, 37. [score:4]
[1 to 20 of 1 sentences]
6
[+] score: 3
Of particular note, in this context, are miR-182 and miR-486, which were found to attenuate atrophy-related gene expression in skeletal muscle [38, 56]. [score:3]
[1 to 20 of 1 sentences]
7
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181a-1, hsa-mir-215, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-mir-15b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-141, hsa-mir-143, hsa-mir-152, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-184, hsa-mir-200c, hsa-mir-155, hsa-mir-29c, hsa-mir-200a, hsa-mir-99b, hsa-mir-296, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-342, hsa-mir-148b, hsa-mir-451a, ssc-mir-125b-2, ssc-mir-148a, ssc-mir-15b, ssc-mir-184, ssc-mir-224, ssc-mir-23a, ssc-mir-24-1, ssc-mir-26a, ssc-mir-29b-1, ssc-let-7f-1, ssc-mir-103-1, ssc-mir-21, ssc-mir-29c, hsa-mir-486-1, hsa-mir-499a, hsa-mir-671, hsa-mir-378d-2, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-499, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-27b, bta-mir-31, bta-mir-15b, bta-mir-215, bta-mir-30e, bta-mir-148b, bta-mir-192, bta-mir-200a, bta-mir-200c, bta-mir-23a, bta-mir-29b-2, bta-mir-29c, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-mir-342, bta-let-7f-1, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-125b-2, bta-mir-15a, bta-mir-99b, hsa-mir-664a, ssc-mir-99b, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, bta-mir-141, bta-mir-143, bta-mir-146a, bta-mir-152, bta-mir-155, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-223, bta-mir-224, bta-mir-26a-1, bta-mir-296, bta-mir-29d, bta-mir-378-1, bta-mir-451, bta-mir-486, bta-mir-671, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, ssc-mir-181a-1, ssc-mir-215, ssc-mir-30a, bta-mir-2318, bta-mir-2339, bta-mir-2430, bta-mir-664a, bta-mir-378-2, ssc-let-7a-1, ssc-mir-378-1, ssc-mir-29a, ssc-mir-30e, ssc-mir-499, ssc-mir-143, ssc-mir-10b, ssc-mir-486-1, ssc-mir-152, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-99a, ssc-mir-148b, ssc-mir-664, ssc-mir-192, ssc-mir-342, ssc-mir-125b-1, oar-mir-21, oar-mir-29a, oar-mir-125b, oar-mir-181a-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-296, ssc-mir-155, ssc-mir-146a, bta-mir-148c, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, hsa-mir-664b, hsa-mir-378j, ssc-let-7f-2, ssc-mir-29b-2, ssc-mir-31, ssc-mir-671, bta-mir-378b, bta-mir-378c, hsa-mir-486-2, oar-let-7a, oar-let-7f, oar-mir-103, oar-mir-10b, oar-mir-143, oar-mir-148a, oar-mir-152, oar-mir-16b, oar-mir-181a-2, oar-mir-200a, oar-mir-200b, oar-mir-200c, oar-mir-23a, oar-mir-26a, oar-mir-29b-1, oar-mir-30a, oar-mir-99a, bta-mir-664b, chi-let-7a, chi-let-7f, chi-mir-103, chi-mir-10b, chi-mir-125b, chi-mir-126, chi-mir-141, chi-mir-143, chi-mir-146a, chi-mir-148a, chi-mir-148b, chi-mir-155, chi-mir-15a, chi-mir-15b, chi-mir-16a, chi-mir-16b, chi-mir-184, chi-mir-192, chi-mir-200a, chi-mir-200b, chi-mir-200c, chi-mir-215, chi-mir-21, chi-mir-223, chi-mir-224, chi-mir-2318, chi-mir-23a, chi-mir-24, chi-mir-26a, chi-mir-27b, chi-mir-296, chi-mir-29a, chi-mir-29b, chi-mir-29c, chi-mir-30a, chi-mir-30e, chi-mir-342, chi-mir-378, chi-mir-451, chi-mir-499, chi-mir-671, chi-mir-99a, chi-mir-99b, bta-mir-378d, ssc-mir-378b, oar-mir-29b-2, ssc-mir-141, ssc-mir-200b, ssc-mir-223, bta-mir-148d
Similarly, Jin et al. (2014a) demonstrated a differential expression of nine miRNAs (bta-miR-184, miR-24-3p, miR-148, miR-486, and let-7a-5p, miR-2339, miR-499, miR-23a, and miR-99b) upon challenge of MACT-cells (bovine mammary epithelia cell line) with heat inactivated E. coli and S. aureus bacteria. [score:3]
[1 to 20 of 1 sentences]
8
[+] score: 2
For example, muscle-specific miRNAs (myomiRs), such as miR-1, miR-133a/b, miR-206, and miR-486, were shown to be involved in the regulation of skeletal muscle hypertrophy by modulating the IGF-1–Akt pathway and myostatin signaling pathway [13– 17]. [score:2]
[1 to 20 of 1 sentences]
9
[+] score: 2
Other miRNAs from this paper: ssc-mir-122, ssc-mir-486-1, ssc-mir-192, ssc-mir-504, ssc-mir-451
Table 1 Primers used for the validation of selected miRNA and their target mRNA miRNA/mRNA Primers ssc-mir-122 GTGGAGTGTGACAATGGTGTTTGA ssc-mir-451 CGAGGAAACCGTTACCATTACTGAGTT ssc-mir-504 GGAGACCCTGGTCTGCACTCTATCT ssc-mir-486 CCTGTACTGAGCTGCCCCGA ssc-mir-192 CCTGACCTATGAATGACAGCCAAA 5SRNA GGTTAGTACTTGGATGGGAGACTGCCT GAPDH-F TCTTCTGGGTGGCAGTGAT GAPDH-R GTTTGTGATGGGCGTGAA NFAT5-F AGGGTAGTCGTGGCTCAGTA NFAT5-R CAGGGAGTTGTATTTCGCC NPEPPS-F AGATGGTGTGTGTGTCCGT NPEPPS-R CGTGATGAAGAACAGGAGTT For the mRNA, the was performed using the TaKaRa PrimeScript™ RT Reagent Kit and gDNA Eraser (TaKaRa), which comprised a genomic DNA elimination reaction, reverse-transcription reaction and RT-PCR. [score:1]
Table 1 Primers used for the validation of selected miRNA and their target mRNA miRNA/mRNA Primers ssc-mir-122 GTGGAGTGTGACAATGGTGTTTGA ssc-mir-451 CGAGGAAACCGTTACCATTACTGAGTT ssc-mir-504 GGAGACCCTGGTCTGCACTCTATCT ssc-mir-486 CCTGTACTGAGCTGCCCCGA ssc-mir-192 CCTGACCTATGAATGACAGCCAAA 5SRNA GGTTAGTACTTGGATGGGAGACTGCCT GAPDH-F TCTTCTGGGTGGCAGTGAT GAPDH-R GTTTGTGATGGGCGTGAA NFAT5-F AGGGTAGTCGTGGCTCAGTA NFAT5-R CAGGGAGTTGTATTTCGCC NPEPPS-F AGATGGTGTGTGTGTCCGT NPEPPS-R CGTGATGAAGAACAGGAGTTFor the mRNA, the was performed using the TaKaRa PrimeScript™ RT Reagent Kit and gDNA Eraser (TaKaRa), which comprised a genomic DNA elimination reaction, reverse-transcription reaction and RT-PCR. [score:1]
[1 to 20 of 2 sentences]
10
[+] score: 1
To verify the accuracy of the high-throughput sequencing results, stem-loop quantitative (q)RT-PCR was performed on 12 significantly DE miRNAs (ssc-miR-10b, ssc-miR-486, ssc-miR-24-3p, ssc-miR-195, ssc-miR-19b, ssc-let-7f, ssc-miR-146b, ssc-miR-novel-chr16_17559, ssc-miR-novel-GL892871-2_41708, ssc-miR-novel-chr2_21624, ssc-miR-novel-chr12_7961, and ssc-miR-26a). [score:1]
[1 to 20 of 1 sentences]
11
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-148a, hsa-mir-10a, hsa-mir-181a-2, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-181a-1, hsa-mir-214, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-23b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-206, hsa-mir-1-1, hsa-mir-128-2, hsa-mir-29c, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-148b, hsa-mir-133b, hsa-mir-424, ssc-mir-125b-2, ssc-mir-148a, ssc-mir-23a, ssc-mir-24-1, ssc-mir-26a, ssc-mir-29b-1, ssc-mir-181c, ssc-mir-214, ssc-mir-27a, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-128-1, ssc-mir-29c, hsa-mir-486-1, hsa-mir-499a, hsa-mir-503, hsa-mir-411, hsa-mir-378d-2, hsa-mir-208b, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-17, ssc-mir-221, ssc-mir-133a-1, ssc-mir-1, ssc-mir-503, ssc-mir-181a-1, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-29a, ssc-mir-199a-2, ssc-mir-128-2, ssc-mir-499, ssc-mir-143, ssc-mir-10a, ssc-mir-486-1, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-23b, ssc-mir-148b, ssc-mir-208b, ssc-mir-424, ssc-mir-127, ssc-mir-125b-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-411, ssc-mir-133a-2, ssc-mir-126, ssc-mir-199a-1, ssc-mir-378-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-499b, ssc-let-7a-2, hsa-mir-378j, ssc-let-7d, ssc-let-7f-2, ssc-mir-29b-2, hsa-mir-486-2, ssc-mir-378b
In addition to the best-studied myomiRs (miR-1, -206 and miR-133 families), 11 other DE muscle-related miRNAs (miR-378 [24], miR-148a [27], miR-26a [28, 29], miR-27a/b [30, 31], miR-23a [32, 33], miR-125b [34], miR-24 [35], miR-128 [36], miR-199a [37] and miR-424 [38]) with high abundance (average RPM >1,000) and another 14 (miR-181a/b/c/d-5p [26], miR-499-5p [11], miR-503 [38], miR-486 [39], miR-214 [40], miR-29a/b/c [41– 43], miR-221/222 [44] and miR-208 [11] with low abundance (average RPM <1,000) were detected in myogenesis of pig. [score:1]
[1 to 20 of 1 sentences]
12
[+] score: 1
For example, the average increase of miR-486 signal from E33 to E65 was 3.3-fold, and 13.4-fold from E65 to Adu; the average increase of miR-376b signal from E33 to E65 was 4.6-fold, but decreased 54.7-fold from E65 to Adu, and therefore in Adu it appeared 11.9-fold lower than in E33; miR-422a signal increased more than 6.9-fold from E33 to E65, after which it remained stable; miR-495 signal was strong in E33 and E65, but nearly undetectable in the Adu stage. [score:1]
[1 to 20 of 1 sentences]