sort by

242 publications mentioning hsa-mir-451b (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-451b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 442
Importantly, upregulation of c-Myc could partially rescue the decreased expression of survivin and rad-51 induced by miR-451 upregulation, while silencing of c-Myc could also partially rescue the increased expression of survivin and rad-51 induced by miR-451 downregulation (Figure 6H). [score:14]
Re -expression of miR-451 downregulates rad-51 and survivin expression by post-transcriptionally downregulating c-Myc. [score:11]
Present data demonstrate that re -expression of miR-451 downregulates the expression of rad-51 and survivin by targeting c-Myc, which promotes DNA DSBs and induces apoptosis enhancement, and eventually reverses radioresistance of docetaxel-resistant LAD cells. [score:10]
The proto-oncogene c-Myc was identified as a direct target of miR-451, and re -expression of miR-451 significantly inhibited the expression of survivin and rad-51 by reducing the amount of c-Myc protein binding to the promoters of survivin and rad-51. [score:10]
By performing a computational screen for genes with complementary sites of miR-451 in their 3'-UTR using open access softwares (TargetScan, miRBase targets and PicTarget), c-Myc might be a putative target of miR-451. [score:9]
In this study, we showed that upregulation of miR-451 significantly reduced the luciferase activity of the c-Myc-3'-UTR reporter and decreased protein expression of c-Myc, suggesting that c-Myc might be a conserved target gene of miR-451. [score:8]
Here, both re -expression of miR-451 and silencing of c-Myc could significantly downregulate the expression of rad-51 and survivin by reducing the amount of c-Myc binding to the promoters of survivin and rad-51. [score:8]
In previous study, we have analyzed the miRNA expression profiles in NSCLC by use of a miRNA microarray platform and identified 40 differentially expressed miRNAs, and miR-451 was found to be the most downregulated. [score:8]
In our previous study, miR-451 was observed to be downregulated in non-small cell lung cancer and re -expression of miR-451 could inhibit growth and induce apoptosis in both LAD cells and squamous cell carcinoma (SCC) cells [15]. [score:8]
The results of qRT-PCR confirmed the upregulation of miR-451 in pcDNA/miR-451 -transfected SPC-A1/DTX or H1299/DTX cells and the downregulation of miR-451 in Anti-miR-451 -transfected SPC-A1 or H1299 cells, in comparison with respective control cells (Figure 1B). [score:7]
Meanwhile, compared with those cells transfected with Anti-miR-NC alone or combined with irradiation treatment (2.0 Gy), the expression of C-caspase-3 protein in miR-451 -downregulated H1299 and SPC-A1 cells combined with irradiation treatment was significantly decreased, but the expression of total Caspase-3 protein showed no significant difference (Supplementary Figure 2B). [score:7]
Likewise, downregulation of miR-451 and upregulation of c-Myc could lead to the increased transcriptional activity of survivin and rad-51 promoters in SPC-A1 cells (Figure 6D). [score:7]
In another report, the over-expressed miR-451 in colon cancer cells was found to inhibit AMPK to activate mTORC1, which mediates FSCN1 expression and cancer cell progression [33]. [score:7]
Li and his colleagues showed that miR-451 inhibits growth of human colorectal carcinoma cells via downregulation of PI3k/Akt pathway [32]. [score:6]
Also, the mRNA and protein expression levels of these genes were significantly upregulated in Anti-miR-451 -transfected SPC-A1 or H1299 cells in comparison with Anti-miR-NC -transfected cells (Figure 5E). [score:6]
Next, we determine the activity of survivin or rad-51 promoter reporters in pcDNA/miR-451 -transfected SPC-A1/DTX cells co -transfected with pcDNA/c-Myc, and showed that overexpression of c-Myc could partially rescue the decreased activity of survivin or rad-51 promoter reporters induced by miR-451 upregulation (Figure 6G). [score:6]
Interestingly, overexpression of miR-451 in gastric and colorectal cancer cells reduced cell proliferation and increased sensitivity to radiotherapy by regulation of macrophage migration inhibitory factor production [37]. [score:6]
To further confirm that c-Myc is involved in the regulation of rad-51 and survivin mediated by miR-451 in LAD cells, we first determine the effect of c-Myc expression on the expression of those proteins. [score:6]
Here, we showed that upregulation of miR-451 significantly decreased protein expression of rad-51, which eventually led to the increased DNA DSBs (formation of γ-H2A. [score:6]
Therefore, overexpression of c-Myc partially rescues the effects of miR-451 upregulation on radioresistance of docetaxel-resistant LAD cells. [score:6]
qRT-PCR was performed to detect the expression of miR-451 in docetaxel-resistant and parental LAD cells, and results indicated that miR-451 was significantly downregulated in SPC-A1/DTX and H1299/DTX cells in comparison with the corresponding parental SPC-A1 and H1299 cells (Figure 1A). [score:6]
Overexpression of c-Myc partially reverses the effects of miR-451 upregulation on radioresistance of docetaxel-resistant LAD cells. [score:6]
Therefore, re -expression of miR-451 enhances DNA DSBs and apoptosis by downregulating rad-51 and survivin, which finally leads to the reversal of radioresistance in docetaxel-resistant LAD cells. [score:6]
Figure 1Effect of miR-451 expression on in vitro radiosensitivity of docetaxel-resistant LAD cells(A) qRT-PCR detection of relative miR-451 expression in docetaxel-resistant LAD cells (SPC-A1/DTX and H1299/DTX) and their parental LAD cells (SPC-A1 and H1299). [score:5]
As miRNA can interact with hundreds of genes and a gene can be targeted by many miRNAs, miR-451 may play critical roles in radioresistance of docetaxel-resistant LAD cells by targeting other mRNAs. [score:5]
Overexpression of c-Myc rescues the effects of enhanced miR-451 expression on on radioresistance of docetaxel-resistant LAD cells. [score:5]
As the pro-oncogene c-Myc was identified as a functional target of miR-451, we then focused on understanding the effect of c-Myc expression on radioresistance of docetaxel-resistant LAD cells. [score:5]
In this study, our data indicated that enforced miR-451 expression significantly reduced survivin expression, which led to the increased caspase-3 -dependent apoptosis. [score:5]
Silencing of c-Myc phenocopies the effect of miR-451 on reversing the radioresistance of docetaxel-resistant LAD cells both in vitro and in vivoAs the pro-oncogene c-Myc was identified as a functional target of miR-451, we then focused on understanding the effect of c-Myc expression on radioresistance of docetaxel-resistant LAD cells. [score:5]
Thus, c-Myc, identified as a direct target of miR-451, is responsible for regulation of rad-51 and survivin in docetaxel-resistant LAD cells. [score:5]
Also, miR-451 was found to be significantly correlated with tumor differentiation, pathological stage, lymph node metastasis and poor prognosis of patient, and further researches indicated that miR-451 could inhibit growth and enhance apoptosis of NSCLC cells by targeting RAB14 [15]. [score:5]
Previously, we have shown that miR-451 functions as a tumor suppressor in NSCLC by targeting ras-related protein 14 (RAB14). [score:5]
To further understand the molecular mechanisms involved in regulation of rad-51 and survivin of docetaxel-reistant LAD cells induced by miR-451, the determination of its direct and functional target genes is needed. [score:5]
Significant inverse correlations were observed when three mRNA expression levels (c-Myc, rad-51 and survivin) were plotted against miR-451 expression levels (2-tailed Spearman's correlation; miR-451/c-Myc: r = −0.754, P<0.0001; miR-451/rad-51: r = −0.599, P<0.0001; miR-451/survivin: r = −0.662, P<0.0001) (Supplementary Figure 4E-G). [score:5]
In our previous study, RAB14 has been identified as a functional target of miR-451 in NSCLC, but the expression of RAB14 showed no difference between docetaxel-resistant and parental LAD cells (data not shown). [score:5]
Downregulation of miR-451 was correlated with radioresistance of docetaxel-resistant LAD cells. [score:4]
48 hours after transfection, it was observed that pcDNA/c-Myc could partially rescue the decreased ED [50] values of irradiation in SPC-A1/DTX or H1299/DTX cells induced by miR-451 upregulation (Figure 8A). [score:4]
In the present study, for the first time, we showed that downregulation of miR-451 was significantly correlated with chemo- and radiotherapy cross resistance in LAD cells. [score:4]
The luciferase activity of the pLUC/c-Myc/3'-UTR-wt -transfected cells co -transfected with pcDNA/miR-451 was significantly decreased in comparison with that of the pLUC/c-Myc/3'-UTR-wt -transfected cells co -transfected with pcDNA/miR-NC (Figure 5B), suggesting that c-Myc might be a direct target of miR-451. [score:4]
The proto-oncogene c-Myc, a key transcriptional factor for survivin and rad-51, was identified as a direct and functional target of miR-451. [score:4]
Collectively, silencing of c-Myc mimics the effects of miR-451 upregulation on enhancing irradiation -induced apoptosis and DNA DSBs in docetaxel-resistant LAD cells. [score:4]
Figure 9 Docetaxel-resistant LAD cells acquired radioresistant phenotype where miR-451 was downregulated, resulting in chemo- and radiotherapy cross resistance. [score:4]
Collectively, upregulation of miR-451 could lead to the increased irradiation -induced apoptosis in docetaxel-resistant LAD cells. [score:4]
Thus, miR-451 might regulate chemo- or radiotherapy cross resistance of LAD cells by targeting other mRNAs. [score:4]
Docetaxel-resistant LAD cells acquired radioresistant phenotype where miR-451 was downregulated, resulting in chemo- and radiotherapy cross resistance. [score:4]
Next, we explored whether silencing of c-Myc could recapitulate the effect of miR-451 upregulation on irradiation -induced apoptosis in docetaxel-resistant LAD cells. [score:4]
Upregulation of miR-451 not only increases cisplatin sensitivity of non-small cell lung cancer cell line, but also reverses the resistance of the MCF-7 breast cancer cells to chemotherapeutic drug doxorubicin [35, 36]. [score:4]
Then, the effects of miR-451/c-Myc on the activity of survivin and rad-51 promoters were further analyzed, and results showed that upregulation of miR-451 and silencing of c-Myc could lead to the reduced transcriptional activity of survivin and rad-51 promoters in SPC-A1/DTX cells (Figure 6C). [score:4]
Also, upregulation of c-Myc could partially abrogate the decreased colony-formation capacity of pcDNA/miR-451 -transfected SPC-A1/DTX or H1299/DTX cells with irradiation treatment (4.0Gy) (Figure 8B). [score:4]
Furthermore, silencing of c-Myc could phenocopy the effect of miR-451 upregulation on the reversal of radioresistance in docetaxel-resistant LAD cells by promoting apoptosis and DNA DSBs. [score:4]
Compared with those cells transfected with miR-NC alone or combined with irradiation treatment (4.0 Gy), the expression of C-caspase-3 protein in miR-451-enforced H1299/DTX and SPC-A1/DTX cells combined with irradiation treatment was significantly increased, but the expression of total caspase-3 protein showed no significant difference (Figure 2B). [score:4]
X protein expression in pcDNA/miR-451 (or pcDNA/miR-NC) -transfected H1299/DTX or SPC-A1/DTX cells combined with pcDNA/control or pcDNA/c-Myc co-transfection and irradiation treatment (4.0Gy). [score:3]
Furthermore, ChIP assays indicated that upregulation of miR-451 could reduce the amount of c-Myc binding to the promoters of survivin and rad-51 in vivo (Figure 6E1-2), while silencing of c-Myc could also reduce the amount of c-Myc binding to those promoters in vivo (Figure 6F1-2). [score:3]
Furthermore, we determine whether c-Myc overexpression could rescue miR451 -induced promotion of apoptosis and DNA DSBs. [score:3]
Our data are supported by clinical data where we found a statistically significant inverse correlation between the expression of miR-451 and c-Myc, rad-51 or survivin in LAD tissue samples. [score:3]
Re -expression of miR-451 significantly increases in vivo radiosensitivity of docetaxel-resistant LAD cellsTo further investigate the effect of miR-451 expression on the in vivo radiosensitivity of LAD cells, H1299/DTX cells stably transfected pcDNA/miR-451 or pcDNA/miR-NC were subcutaneously inoculated into nude mice. [score:3]
In the same LAD tissues, we then correlated miR-451 with the mRNA expression levels of c-Myc, rad-51 and survivin. [score:3]
As shown in Figure 3A, when combined with irradiation treatment (4.0 Gy), miR-451 overexpression significantly increased γ-H2A. [score:3]
Thus, re -expression of miR-451 enhances irradiation -induced apoptosis and DNA DSBs in docetaxel-resistant LAD cells. [score:3]
Identification of c-Myc as a target of miR-451 in LAD cells. [score:3]
More importantly, overexpression of c-Myc could partially rescue the effects of enhanced miR-451 on docetaxel-resistant LAD cells. [score:3]
By gain- and loss-of-function assays, upregulation of miR-451 significantly increases the sensitivity of docetaxel-resistant LAD cells to irradiation both in vitro and in vivo by enhancing DNA DSBs and apoptosis. [score:3]
Effect of miR-451 expression on irradiation -induced apoptosis of docetaxel-resistant LAD cells. [score:3]
By using three algorithms, c-Myc was predicated to a potential target of miR-451, which was consistent with the previous study [48]. [score:3]
X protein expression in pcDNA/miR-451(or pcDNA/miR-NC) -transfected SPC-A1/DTX or H1299/DTX treated without irradiation or with irradiation (4.0 Gy). [score:3]
Effect of miR-451 expression on in vitro radiosensitivity of docetaxel-resistant LAD cells. [score:3]
X protein was significantly upregulated in pcDNA/miR-451 -transfected cells compared with in miR-NC -transfected group (Figure 3B). [score:3]
Re -expression of miR-451 could reverse radioresistance of docetaxel-resistant LAD cells through promoting apoptosis and DNA DSBs. [score:3]
As shown in Figure 5D, the expression levels of c-Myc, rad-51 and survivin both mRNA and protein were significantly decreased in pcDNA/miR-451 -transfected SPC-A1/DTX or H1299/DTX cells in comparison with pcDNA/miR-NC -transfected cells. [score:3]
Next, we focused on revealing the underlying molecular mechanisms by which re -expression of miR-451 reversed radioresistance of docetaxel-resistant LAD cells. [score:3]
To further understand the effect of miR-451 expression on the radiosensitivity of docetaxel-resistant LAD cells, pcDNA/miR-451 (or pcDNA/miR-NC) or Anti-miR-451 (or Anti-miR-NC) was stably or transiently transfected into docetaxel-resistant or parental LAD cells, respectively. [score:3]
X protein was significantly downregulated in Anti-miR-451 -transfected cells compared with that in Anti-miR-NC -transfected group (Supplementary Figure 2C). [score:3]
Our previous study has shown that miR-451 functions as a potent tumor suppressor in human NSCLC [15], but the roles of miR-451 in chemo- and radiotherapy cross resistance of LAD are sill unclear. [score:3]
Figure 4Effect of miR-451 expression on in vivo radiosensitivity of docetaxel-resistant LAD cells(A) Growth of tumors in the nude mice subcutaneously transplanted with 3.0×10 [6] pcDNA/miR-NC or pcDNA/miR-451 -transfected H1299/DTX cells combined with irradiation treatment. [score:3]
In the present study, we were the first to show that re -expression of miR-451 could significantly reverse the radioresistance of docetaxel-resistant LAD cells through promoting apoptosis and DNA DSBs both in vitro and in vivo. [score:3]
Re -expression of miR-451 significantly increases irradiation -induced apoptosis and DNA DSBs of docetaxel-resistant LAD cells. [score:3]
Effect of miR-451 expression on irradiation -mediated DNA DSBs of docetaxel-resistant LAD cells. [score:3]
qRT-PCR ands were performed to detect the mRNA and protein expression of c-Myc, rad-51 and survivin in pcDNA/miR-NC or pcDNA/miR-451 -transfected SPC-A1/DTX and H1299/DTX cells. [score:3]
Therefore, re -expression of miR-451 significantly increases the in vivo radiosensitivity of docetaxel-resistant LAD cells. [score:3]
qRT-PCR ands were performed to detect the mRNA and protein expression of c-Myc, rad-51 and survivin in Anti-miR-NC or Anti-miR-451 -transfected SPC-A1 and H1299 cells. [score:3]
Effect of miR-451 expression on in vivo radiosensitivity of docetaxel-resistant LAD cells. [score:3]
In consensus with our previous report [26], miR-451 was found to be predominantly downregulated in LAD tissues, compared with corresponding nontumor tissues (Supplementary Figure 6A). [score:3]
At the same time, the tumor suppressor functions of miR-451 in other types of human malignancies are increasingly reported. [score:3]
Re -expression of miR-451 significantly increases in vivo radiosensitivity of docetaxel-resistant LAD cells. [score:3]
Flow cytometry was performed to determine the effect of miR-451 expression on irradiation -induced apoptosis in docetaxel-resistant and parental LAD cells, and it was observed that the apoptosis of miR-451-enforced H1299/DTX or SPC-A1/DTX cells combined with irradiation treatment (4.0 Gy) was significantly increased compared with that in miR-NC -transfected cells combined with irradiation treatment (Figure 2A). [score:2]
Thus, this newly identified miR-451/c-Myc-rad-51/survivin signaling pathway provides novel insight into the molecular mechanisms which regulate chemo- and radiotherapy cross resistance, and further provides a promising strategy for the treatment of chemoresistant LAD in future. [score:2]
Then, the effect of miR-451 expression on radiosensitivity of LAD cells was determined by the clonogenic survival assay. [score:2]
Then, we explored whether miR-451 was involved in the regulation of these radioresistance-related genes. [score:2]
Flow cytometry assay showed that c-Myc overexpression could rescue the increased apoptosis of pcDNA/miR-451 -transfected SPC-A1/DTX or H1299/DTX cells combined with irradiation treatment (4.0Gy) (Figure 8C). [score:2]
Therefore, dysregulation of miR-451/c-Myc-rad-51/survivin signaling might be correlated with chemo- and radiotherapy cross resistance of LAD cells. [score:2]
To further determine whether c-Myc was a direct target of miR-451, we investigated the binding site of miR-451 in the 3'-UTR sequence of c-Myc mRNA (1891-1912 nt). [score:2]
Luciferase reporter containing wild type 3'-UTR of c-Myc (pLUC/c-Myc/3'-UTR-wt) in which the nucleotides of the c-Myc-3'-UTR complementary to miR-451 were inserted into the pGL3-Basic vector, and we also generated a mutant reporter (pluc/c-Myc/3'-UTR-mut) from the wild type with point mutation. [score:2]
Therefore, loss of miR-451 during chemo- and radiotherapy cross resistance of LAD cells is likely to lead mis-regulation of this network (Figure 9). [score:2]
To further study the effect of miR-451 on regulation of irradiation -induced DNA DSBs, pcDNA/miR-451 or pcDNA/miR-NC was stably transfected into docetaxel-resistant LAD cells, and then the cells were treated with irradiation treatment (4.0 Gy). [score:2]
However, the roles of miR-451 in chemo- and radiotherapy cross resistance of LAD cells are not better understood and need to be further elucidated. [score:1]
The ED [50] values for irradiation in miR-451 -transfected SPC-A1/DTX or H1299/DTX cells were significantly decreased by 48.0% or 56.1%, respectively, in comparison with those in miR-NC -transfected cells (Figure 1C). [score:1]
Thus, the newly identified miR-451/c-Myc-survivin/rad-51 signaling was linked with chemo- and radiotherapy cross resistance of human LAD cells. [score:1]
Figure 2(A) in pcDNA/miR-451(or pcDNA/miR-NC) -transfected SPC-A1/DTX or H1299/DTX treated without irradiation or with irradiation (4.0 Gy). [score:1]
To further investigate the effect of miR-451 expression on the in vivo radiosensitivity of LAD cells, H1299/DTX cells stably transfected pcDNA/miR-451 or pcDNA/miR-NC were subcutaneously inoculated into nude mice. [score:1]
c-Myc is inversely correlated with miR-451 and positively correlated with rad-51 and survivin in LAD tissues. [score:1]
For stable transfection, the cell lines transfected with pcDNA/miR-451 (or pcDNA/miR-NC) or sh-c-Myc#1, 2 or 3 (sh-control) vector were stably selected with G418 (400 mg/mL). [score:1]
X proteins in pcDNA/miR-451 -transfected SPC-A1/DTX or H1299/DTX cells combined with irradiation treatment (4.0Gy) (Figure 8D). [score:1]
ChIP assay was performed with antibody directly against c-Myc in SPC-A1/DTX cells transfected with pcDNA/control or pcDNA/miR-451, repectively. [score:1]
A proposed mo del for miR-451/c-Myc-rad-51/survivin signaling pathway in chemo- and radiotherapy cross resistance in LAD cells. [score:1]
Meanwhile, the ED [50] values for irradiation in Anti-miR-451 -transfected SPC-A1 or H1299 cells were significantly increased by 30.0% or 15.2%, respectively, in comparison with those in Anti-miR-NC -transfected cells (Figure 1D). [score:1]
Godlewski' et al identified a potential feedback loop between LKB1 and miR-451, and showed that microRNA-451 is a conditional switch controlling glioma cell proliferation and migration [31]. [score:1]
To further confirm that c-Myc was involved in miR-451 -mediated chemo- and radiotherapy cross resistance in LAD cells, pcDNA/c-Myc or pcDNA/control was transfected into docetaxel-resistant LAD cells stably transfected with pcDNA/miR-451 or pcDNA/miR-NC. [score:1]
X foci formation in pcDNA/miR-451(or pcDNA/miR-NC) -transfected SPC-A1/DTX cells combined with pcDNA/control or pcDNA/c-Myc co-transfection and irradiation treatment (4.0Gy). [score:1]
However, whether miR-451 plays a critical role in chemo- or radiotherapy cross resistance in LAD cells is still unclear. [score:1]
The associations of miR-451 with chemo- or radiosensitivity of tumor cells are also reported. [score:1]
X) foci formation (a marker of DSB) in pcDNA/miR-451(or pcDNA/miR-NC) -transfected SPC-A1/DTX or H1299/DTX treated without irradiation or with irradiation (4.0 Gy). [score:1]
These data further support the existence of a novel miR-451/c-My-rad-51/survivin signaling pathway in LAD. [score:1]
Meanwhile, miR-451 is reported to be involved in the self-renewal, tumorigenicity, and chemoresistance of colorectal cancer stem cells [34]. [score:1]
To the best of our knowledge, this is the first report about the involvement of miR-451/c-Myc-survivin/rad-51 signaling in chemo- and radiotherapy cross resistance of LAD cells. [score:1]
These data indicated that miR-451 repression might play critical roles in radioresistance of docetaxel-resistant LAD cells. [score:1]
We generated a luciferase reporter (pLUC/c-Myc/3'-UTR-wt) in which the nucleotides of the c-Myc-3'-UTR complementary to miR-451 were inserted into the pLUC vector, and we also generated a mutant reporter (pLUC/c-Myc/3'-UTR-mut). [score:1]
The tumors of H1299/DTX/miR-451 group grew more slowly than those of H1299/DTX/miR-NC group, when combined with irradiation treatment (Figure 4A). [score:1]
Silencing of c-Myc phenocopies the effect of miR-451 on reversing the radioresistance of docetaxel-resistant LAD cells both in vitro and in vivo. [score:1]
pcDNA/miR-451 (or pcDNA/miR-NC) and Anti-miR-451 (or Anti-miR-NC) were used as our previously described [10]. [score:1]
[1 to 20 of 119 sentences]
2
[+] score: 281
Other miRNAs from this paper: hsa-mir-27a, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-451a
showed that the upregulation of miR-451 could significantly downregulate the expression of pAkt protein but had no effects on the expression of total Akt protein. [score:11]
In the present study, we identify miR-451 to be downregulated in human NSCLC and report for the first time that upregulation of miR-451 can enhance DDP chemosensitivity in NSCLC cell line (A549) by inducing apoptosis enhancement, which identifies miR-451 as a valid therapeutic target in strategies employing novel multimodality therapy for patients with NSCLC. [score:9]
In conclusion, upregulation of miR-451 could increase the sensitivity of A549 cells to DDP both in vitro and in vivo, suggesting that appropriate combination of DDP application with miR-451 upregulation might be a potential strategy for the treatment of human NSCLC in future. [score:7]
The expression of miR-451 could be significantlu upregulated in A549 cells by pcDNA-GW/miR-45. [score:6]
Upregulation of miR-451 expression inactivates the Akt signaling pathway of A549 cells. [score:6]
To upregulate the expression of miR-451 in NSCLC cell line (A549), pcDNA-GW/miR-451 was transfected and stable transfectants (A549/miR-451 or A549/miR-NC) were successfully established. [score:6]
Olga and his colleagues reported that the enforced increase of miR-451 levels in the MCF-7/DOX cells down-regulates expression of mdr1 and increases sensitivity of the MCF-7-resistant cancer cells to DOX [14]. [score:6]
Although inhibition of Akt signal pathway has been reported to be able to improve chemotherapeutic effect of human tumor cells, whether upregulation of miR-451 enhance DDP chemosensitivity of A549 cells by inactivating the Akt signal pathway needs to be further elucidated. [score:6]
In the present study, we found that the upregulation of miR-451 could significantly inhibit growth and colony formation of NSCLC cell line (A549). [score:6]
Upregulation of miR-451 inhibits growth and enhances apoptosis of NSCLC cell line (A549). [score:6]
Thus, upregulation of miR-451 could induce growth inhibition and apoptosis enhancement in A549 cells. [score:6]
The gel electrophoresis of RT-PCR products confirmed the downregulation of miR-451 expression in NSCLC tissues (Figure 1B). [score:6]
The gel electrophoresis of RT-PCR products confirmed the upregulation of miR-451 expression in A549/miR-451 cells (Figure 2B). [score:6]
Ectopic overexpression of miR-451 could significantly inhibit growth and induce apoptosis of A549 cells. [score:5]
A549 cells were seeded into 6-well plates and transfected with the miR-415 -expressing vector or the control vector expressing a non-specific miR-NC using Lipofectamine 2000 (Invitrogen), and were selected with spectinomycin (100 μg/ml) to generate two stable monoclonal cell lines (a miR-218 stable cell line, A549/miR-451, and a control stable cell line, A549/miR-NC). [score:5]
It was also reported that miR-451 might function as tumor suppressor and modulate MDR1/P-glycoprotein expression in human cancer cells [13]. [score:5]
As shown in Figure 2A, qRT-PCR assay showed that the relative level of miR-451 expression in A549/miR-451 could be significantly upregulated by 3.8-fold compared with that in mock A549 or A549/miR-NC cells (P < 0.05). [score:4]
Therefore, it was concluded that the downregulation of miR-451 might be involved in lung carcinogenesis. [score:4]
To the best of our knowledge, we provided the first insight into the roles and possible mechanisms of miR-451 upregulation in chemosensitivity of A549 cells to DDP. [score:4]
It was also reported that microRNA-451 could regulate macrophage migration inhibitory factor production and proliferation of gastrointestinal cancer cells [21]. [score:4]
Figure 5 Effect of miR-451 upregulation on the in vitro sensitivity of A549 cells to DDP. [score:4]
For higher-dose DDP would produce potentially serious toxic effects such as nephro- and ototoxicity would be increased, combination of DDP application with miR-451 upregulation for the treatment of NSCLC would contribute to lower-dose DDP administration and result in a reduction of DDP toxic side-effects. [score:4]
To explore whether upregulation of miR-451 on chemosensitivity of A549 cells to DDP in vivo, s. c. tumors were developed in nude mice followed by treatment with DDP or PBS. [score:4]
Figure 7 Effect of miR-451 upregulation on the in vivo sensitivity of A549 cells to DDP. [score:4]
Figure 3 Effect of miR-451 upregulation on growth and apoptosis of A549 cells. [score:4]
Upregulation of miR-451 enhances DDP -induced apoptosis of A549 cells. [score:4]
Like the results observed from in vitro experiments, upregulation of miR-451 could also increase in vivo chemosensitivity of A549 cells to DDP by inducing apoptosis enhancement. [score:4]
Upregulation of miR-451 increases in vivo chemosensitivity of A549 cells to DDP. [score:4]
Upregulation of miR-451 enhances in vitro sensitivity of A549 cells to DDP. [score:4]
Upregulation of miR-451 could also enhance caspase-3 -dependent apoptosis of A549 cells by inactivating the Akt signalling pathway which induced the reverse of Bcl-2/Bax ratio. [score:4]
Finally, the effects of miR-451 upregulation on in vitro and in vivo sensitivity of A549 cells of DDP were also determined. [score:4]
Zhu, et al demonstrate for the first time the roles of miRNAs in the regulation of drug resistance mediated by MDR1/P-glycoprotein, and suggest the potential for targeting miR-27a and miR-451 as a therapeutic strategy for modulating MDR in cancer cells [13]. [score:4]
Figure 6 Effect of combined miR-451 upregulation with DDP (5 μg/ml) on apoptosis of A549 cells. [score:4]
Therefore, upregulation of miR-451 might increase DDP chemosensitivity of A549 cells by enhancing DDP -induced apoptosis. [score:4]
This study demonstrated for the first time that combination of DDP application with miR-451 upregulation might be a potential strategy for the treatment of human NSCLC. [score:4]
Figure 4 Effect of miR-451 upregulation on the Akt signaling pathway. [score:4]
Furthermore, upregulation of miR-451 could significantly increase the in vitro and in vivo sensitivity of A549 cells to DDP. [score:4]
Moreover, ectopic overexpression of miR-451 could sensitize A549 cells to DDP possibly by increasing DDP -induced apoptosis which might be associated with the inactivation of Akt signaling pathway. [score:3]
Recently, miR-451 as a tumor suppressor has been reported in other studies. [score:3]
Here, we showed that miR-451 is frequently downregulated in human NSCLC tissues compared with corresponding noncancerous lung tissues, which is consistent with the results of Gao'et al [20]. [score:3]
A. Western Blot analysis of pAkt (473), total Akt, Bcl-2 and Bax protein expression in mock A549, A549/miR-NC or A549/miR-451 cells. [score:3]
MiR-451 is significantly downregulated in human NSCLC tissues. [score:3]
However, whether miR-451 expression affects the sensitivity of NSCLC cells is not fully understood. [score:3]
Thus, miR-451 was proposed as a tumor-suppressor of human cancers. [score:3]
However, to our best knowledge, there have been no reports about the association of miR-451 expression with the sensitivity of NSCLC cells to DDP. [score:3]
The level of miR-451 expression in NSCLC tissues was significantly higher than that in corresponding noncancerous tissues. [score:3]
B. Conventional stem-loop RT-PCR analysis of miR-451 expression in A549, A549/miR-NC or A549/miR-451 cells. [score:3]
Figure 2 Detection of miR-451 expression in mock or stably transfected A549 cells. [score:3]
However, whether the expression of miR-451 can affect the sensitivity of lung cancer cells to DDP is still unclear. [score:3]
B. Conventional stem-loop RT-PCR analysis of miR-451 expression in NSCLC and corresponding noncancerous tissues. [score:3]
A. Quantitative RT-PCR analysis of miR-451 expression in 10 cases of NSCLC and corresponding noncancerous tissues. [score:3]
Figure 1 Detection of miR-451 expression in tissue samples. [score:3]
A. Quantitative RT-PCR analysis of miR-451 expression in A549, A549/miR-NC or A549/miR-451 cells. [score:3]
To determine this, the mock or stably transfected A549 cells were treated with various concentrations (0, 5, 10, 15, 20 and 25 μg/ml) of DDP for 12 h or 5 μg/ml of DDP for 0, 12, 24, 26 and 48 h. The results from MTT assay indicated that upregulation of miR-451 led to a significant decrease in cell viability of A549 cells in response to DDP in a dose- or time -dependent manner compared with those of A549/miR-NC and mock A549 cells (Figure 5A and 5B). [score:2]
Recently miR-451 has been reported to be induced during zebrafish, mouse, and human erythroid maturation as an key factor involved in regulates erythrocyte differentiation [10- 12]. [score:2]
In other reports, Godlewski and his colleagues showed that miRNA-451 regulates LKB1/AMPK signaling and allows adaptation to metabolic stress in glioma cells, which represents a fundamental mechanism that contributes to cellular adaptation in response to altered energy availability [23]. [score:2]
Then, the effects of miR-451 upregulation on growth, colony formation and apoptosis of A549 cells were investigated. [score:2]
Quantitative RT-PCR assay was performed to detect the expression of miR-451 in 10 pairs of NSCLC and noncancerous tissue samples. [score:2]
To analyze the effect of miR-451 expression on phenotypes of NSCLC cell line, we performed MTT, colony formation and flow cytometric assays. [score:2]
These data suggest that appropriate combination of DDP application with miR-451 regulation might be a potential approach to NSCLC therapy. [score:2]
The precise underlying mechanisms by which upregulation of miR-451 enhances chemosensitivity of A549 cells to DDP were further investigated. [score:2]
Nan and his colleagues revealed that miR-451 impacts glioblastoma cell proliferation, invasion and apoptosis, perhaps via regulation of the PI [3]K/AKT signaling pathway [22]. [score:2]
In this study, a stem-loop qRT-PCR assay was performed to determine the expression of miR-451 in 10 pairs of matched NSCLC and noncancerous lung tissue samples. [score:2]
In addition, conventional RT-PCR assay was also performed to analyze the expression of miR-451 in 2 pairs of matched NSCLC and noncancerous tissue samples. [score:2]
At 28 days after inoculation, the average tumor volume of A549/miR-451 cells (212 ± 36 mm [3]) was significantly lower than that of A549/miR-NC (323 ± 13 mm [3]) following DDP treatment (P < 0.05; Figure 7B). [score:1]
B. Average tumor volume at day 28 after the inoculation of A549/miR-NC or A549/miR-451 cells with or without DDP treatment (n = 8/group). [score:1]
B. Hoechst staining analysis of apoptosis in mock A549, A549/miR-NC or A549/miR-451 cells. [score:1]
B. Detecting colony formation ability of mock A549, A549/miR-NC or A549/miR-451 cells, *P < 0.05. [score:1]
Thus, we analyzed the effects of miR-451 on the Akt signaling pathway in A549 cells (Figure 4A). [score:1]
As shown in Figure 5C, the number of colonies formed from A549/miR-451 cells treated with DDP was significantly lower than that formed from A549/miR-NC and mock A549 cells (P < 0.05). [score:1]
At the same time, they also identified a potential feedback loop between LKB1 and miR-451, which allows a sustained and robust response to glucose deprivation [24]. [score:1]
As shown in Figure 6A, the apoptotic rare of A549/miR-451 treated with 5 μg/ml DDP was increased by approximately 11.7% in comparison with mock A549 cells treated with 5 μg/ml DDP (P < 0.05). [score:1]
B. Analysis of relative caspase-3 activity in mock A549, A549/miR-NC or A549/miR-451 cells. [score:1]
These data obviously showed that upresgulation of miR-451 might effectively enhance the sensitivity of A549 cells to DDP. [score:1]
C. Effects of 5 μg/ml DDP on colony formation of cells (mock A549, A549/miR-NC or A549/miR-451). [score:1]
Therefore, it was concluded that the elevation of caspase-3 activity might be induced by the elevated ratio of Bax/Bcl-2. However, the exact mechanisms of miR-451 affecting the Akt signaling pathway need to be elucidated in future. [score:1]
The constructed vectors were named pcDNA-GW/EmGFP-miR-451 and pcDNA-GW/EmGFP-miR-NC, respectively. [score:1]
Approximately 500 mock A549 or stable transfect A549 cells (A549/miR-451 and A549/miR-NC) were placed in a fresh 6-well plate with or without DDP for another 12 h and maintained in RMPI 1640 containing 10% FBS for 2 weeks. [score:1]
C. Flow cytomerty analysis of apoptosis in mock A549, A549/miR-NC or A549/miR-451, * P < 0.05; N. S, P > 0.05. [score:1]
C. Analysis of relative caspase-3 activity in mock A549, A549/miR-NC or A549/miR-451 cells. [score:1]
A. Growth of tumors in the mice injected with A549/miR-451 or A549/miR-451 with or without DDP treatement. [score:1]
pcDNA-GW/EmGFP-miR-451 was stably transfected into NSCLC cell line (A549). [score:1]
C. TUNEL staining analysis of apoptosis in tumor tissues at day 28 after the inoculation of A549/miR-NC or A549/miR-451 cells with or without DDP treatment (n = 8/group). [score:1]
A. in mock A549, A549/miR-NC or A549/miR-451 cells. [score:1]
However, whether miR-451 can affect the sensitivity of non-small cell lung cancer (NSCLC) cells to cisplatin (DDP) remains unclear. [score:1]
Moreover, flow cytometric analysis showed that the apoptotic rate of A549/miR-451 cells (11.6 ± 1.5%) was significantly higher than that of mock A549 or A549/miR-NC cells (P < 0.05; Figure 3C). [score:1]
Meanwhile, miR-451 has been reported to be involved in resistance of the MCF-7 breast cancer cells to chemotherapeutic drug doxorubicin [14]. [score:1]
The number of colonies formed from A549/miR-451 cells was significantly lower than that formed from mock A549 or A549/miR-NC cells (P < 0.05; Figure 3B). [score:1]
A. MTT analysis of cell viability in mock A549, A549/miR-NC or A549/miR-451 cells. [score:1]
[1 to 20 of 89 sentences]
3
[+] score: 232
As shown in Figures 5a–d, overexpression of miR-451 reduced β-catenin, c-Myc and cyclinD1 expression in both two PR cell lines, on the other hand, as shown in Figures 5e–h, downregulate miR-451 had the opposite effect and the expression of β-catenin, c-Myc and cyclinD1 increased in their parent cell lines. [score:10]
Our findings suggested that overexpression of miR-451 increased BC cell resistance to paclitaxel mainly through downregulating YWHAZ expression in vitro and in vivo. [score:8]
[39] In line with the role of miRNAs in regulating Wnt/ β-catenin, we found that upregulation miR-451 could decrease β-catenin expression in PR cells and in xenograft mouse mo del. [score:7]
Transfected miR-45 mimics resulted in significant reduction of YWHAZ mRNA and protein, whereas miR-451 inhibitor treatment caused the upregulation of YWHAZ in SKBR3 and MCF-7 cells (Figures 4c–f). [score:6]
[21] In order to confirm miR-451 regulation of β-catenin expression via YWHAZ, the mRNA and protein levels of β-catenin and its downstream target genes were examined by qRT-PCR and western blot. [score:6]
To identify the role of miR-451 in BC development, firstly, 104 samples of patients with BC that provided by TCGA data portal were detected in this study, as shown in Figure 1a, the expression of miR-451 was significantly downregulated in BC samples compared to matched adjacent normal breast tissue. [score:6]
[25] In terms of the association of miR-451 and drug resistance, it has recently been reported that overexpression of miR-451 in gastric and colorectal cancer cells reduced cell proliferation and increased sensitivity to radiotherapy by regulating macrophage migration -inhibitory factor production. [score:6]
After the indicated periods of incubation, the expression of miR-451/YWHAZ and other target genes was assessed with qRT-PCR detection system and western blot apparatus. [score:5]
[20] Therefore, to explore the molecular mechanism by which miR-451 modulates PR, publicly available algorithms (TargetScan, PicTar and miRanda) were used in combination to predict for potential targets of miR-451. [score:5]
In current study, we found that miR-451 expression was downregulated in the paclitaxel-resistant human BC cell lines compared to their parental cell lines. [score:5]
In accordance with the results of the experiments performed in vitro, miR-451 decreased the mRNA and protein expression level of β-catenin and two WNT transcriptional targets, c-Myc and cyclin D1, were decreased concurrently (Figures 10f and g). [score:5]
Cells and PR cells transfected with miR-451 mimics, miR-451 mimics NC, miR-451 inhibitor, miR-451 inhibitor NC or YWHAZ-siRNA were rinsed with PBS (pH 7.4) and then harvested and lysed in RIPA lysis buffer (Beyotime, Shanghai, China) with freshly added PMSF (Beyotime) for 30 min on ice. [score:5]
MiR-451 expression is significantly downregulated in breast cancer. [score:5]
Furthermore, miR-451 may induce apoptosis and cell-cycle arrest of PR cells through directly targeting the YWHAZ/ β-catenin signaling pathway. [score:4]
29, 30, 31 To determine the mechanism by which miR-451 regulates paclitaxel-resistant in BC, we predicted its target genes through bio-information analysis. [score:4]
[24] Moreover, a recent study showed that miR-451 inhibited the migration of HepG2 and SK-Hep-1 cells via the regulation of ATF2 in HCC. [score:4]
Validation of YWHAZ as a direct and specific target of miR-451. [score:4]
[26] In addition, miR-451 has been reported to be correlated with chemosensitivity of BC cells to doxorubicin (DOX) via direct targeting of ABCB1 and NSCLC cells to cisplatin. [score:4]
Moreover, we observed that miR-451 inhibitor increased YWAHZ 3′-UTR wild-type, but not YWAHZ mutation, in SKBR3 cells and MCF-7 cells. [score:4]
We consequently conducted further analysis to explore whether miR-451 regulated YWHAZ expression in PR cells. [score:4]
Furthermore, to validate whether YWHAZ is a direct and specific target of miR-451, miR-451 mimics and YWAHZ 3′-UTR wild type or 3′-UTR mutated luciferase reporter were transfected into SKBR3/PR and MCF-7/PR cells. [score:4]
These results indicated that YWHAZ gene was a direct target of miR-451 and might contribute to miR-451 -mediated PR in BC. [score:4]
Cells were seeded in six-well plates and transfected with miR-451 mimics, miR-451 inhibitors or YWHAZ-siRNA using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to manufacturer’s protocol. [score:3]
These results indicated that reduced miR-451 expression was a frequent event in human BC tissues and cells, which may be involved in breast carcinoma progression (Figures 1b and c). [score:3]
Finally, we explored the potential mechanism of the tumor-suppressive role of miR-451. [score:3]
To clarify the importance of the role of YWHAZ for miR-451 -mediated inhibition of cell migration and invasion, cells were transfected with YWHAZ siRNA. [score:3]
By contrast, miR-451 inhibitor treatment led to increased cell invasion and migration in SKBR3 and MCF-7 cells (Figures 2c and d). [score:3]
The scratch wound was generated in the surface of the plates using a pipette tip in cells with miR-451 mimics, miR-451 inhibitors transfection or YWHAZ siRNA treatment. [score:3]
[44] This study suggested that miR-451 could decrease the mRNA and protein expression level of β-catenin, c-Myc and cyclin D1. [score:3]
In addition, the alteration of the cell-cycle distribution following miR-451 overexpression in the two PR cell lines was also analyzed. [score:3]
These results supported that miR-451 targets to YWHAZ. [score:3]
As shown in Figures 2a and b, miR-451 mimics significantly inhibited the cell invasion and migration in both SKBR3/PR and MCF-7/PR cells. [score:3]
YWHAZ inhibition is required for miR-451 -mediated effects. [score:3]
We showed that expression of miR-451 was significantly lower in paclitaxel-resistant cells than their parental cells. [score:3]
The miR-451 mimic, and its NC, miR-451 inhibitors and its NC were purchased from Shanghai Gene Pharma Cells. [score:3]
Among these genes, YWHAZ was identified as a potential target of miR-451 and was selected for further experimental verification. [score:3]
In summary, we demonstrated that miR-451 suppressed migration and invasion in BC in vitro and in vivo. [score:3]
MiR-451 showed the larger degree of downregulation (5.6-fold). [score:3]
Cells treated with control, miR-451 mimics, or miR-451 inhibitors were cotransfected with wild-type or mutants of YWHAZ 3′-UTR luciferase reporters together with Renilla plasmid. [score:3]
Prediction of YWHAZ as a target of miR-451. [score:3]
The predicted interaction between miR-451 and the target site in the YWHAZ 3′-UTR is illustrated in Figure 4g. [score:3]
Noticeably, the luciferase activity was significantly suppressed following co-transfection of miR-451 with wt-YWHAZ-3′UTR vector, but not in mutant YWHAZ-3′UTR in SKBR3/PR and MCF-7/PR cells (Figure 4h). [score:3]
[22] In this study, we investigated whether dual inhibition of YWHAZ by si-YWHAZ and overexpression of miR-451 showed synergistic effect. [score:3]
Previous studies have indicated that miR-451 can act as a tumor suppressor in many various types of human cancers, including colorectal cancer, glioblastoma, hepatocellular carcinoma (HCC), and gastric cancer. [score:3]
27, 28 These studies revealed that miR-451 is not only useful as a marker, but also serves as a potential target for novel therapeutic strategies to overcome drug resistance and tumor growth. [score:3]
MiR-451 decreases the mRNA and protein expression level of β-catenin and relative genes of β-catenin signaling pathway in vitro. [score:2]
We subsequently evaluated the potential role of miR-451 in cell apoptosis and cell-cycle regulation by transfecting miR-451 mimics and inhibitor, respectively. [score:2]
On the contrary, the proportion of apoptotic cells transfected with miR-451 inhibitors was decreased in SKBR3 and MCF-7 cells compared with the control (Figure 3c). [score:2]
[38] In this study, co-treatment with miR-451 mimics and YWHAZ-siRNA significantly enhanced YWHAZ knockdown in both SKBR3/PR and MCF-7/PR cells. [score:2]
Role of miR-451 in modulating paclitaxel resistance in vivoIn order to further validate the important role of miR-451 as a regulator on drug sensitivity in BC, we constructed xenograft mo del and drug-resistant xenograft by injecting SKBR3 cells and SKBR3/PR cells, respectively. [score:2]
In our current study, we explored the role of miR-451 in the development of drug resistance in BC. [score:2]
In particular, knockdown of YWHAZ by siRNA displayed a consentaneous phenomenon with the effect of miR-451 in PR cells. [score:2]
As shown in Figure 9a, co-treatment with miR-451 mimics and YWHAZ-siRNA significantly enhanced YWHAZ knockdown in both SKBR3/PR and MCF-7/PR cells. [score:2]
Our findings provided further evidence that miR-451 might be considered as important and potential target for the diagnosis and treatment of paclitaxel-resistant BC. [score:2]
As shown in Figure 11, miR-451 negatively regulated the downstream genes c-Myc and cyclin D1 of β-catenin in Wnt/ β-catenin pathway. [score:2]
MiR-451 suppresses cell migration, invasion and induces cell-cycle arrest and apoptosis in breast cancer. [score:2]
MiR-451 decreases the mRNA and protein expression level of β-catenin and relative genes of β-catenin signaling pathway in vitroPrevious studies had shown that YWHAZ/ β-catenin complex involved in drug resistance in cancer metastasis. [score:2]
To determine whether miR-451 might be involved in drug resistance in BC cells, we compared miR-451 expression between the paclitaxel-resistant cells and their parental cells. [score:2]
In order to further validate the important role of miR-451 as a regulator on drug sensitivity in BC, we constructed xenograft mo del and drug-resistant xenograft by injecting SKBR3 cells and SKBR3/PR cells, respectively. [score:2]
The results showed that the apoptotic rate of tumors developed from SKBR3/PR/miR-451 agomir groups was significantly higher than that of tumors developed from SKBR3/PR/agomir-NC following 4 weeks of treatment. [score:1]
[23] MiR-451 is identified to control the regulation of glioblastoma cell proliferation, invasion and apoptosis through the PI3K/AKT signaling pathway. [score:1]
The mean weight of the tumors extracted from the miR-451 antagomir group was significantly higher than those extracted from the NC antagomir group. [score:1]
To investigate the biological role of miR-451 in BC progression, we performed in vitro gain and loss-of-function analyses in PR and their parent cell lines transfected with miR-451 mimics and inhibitor. [score:1]
Furthermore, miR-451 may be involved in cell proliferation, migration and apoptosis in cell lines. [score:1]
23, 24, 25 For example, Bitarte et al. found that miR-451 caused a decrease in self-renewal, tumorigenicity, and chemoresistance to irinotecan of colon spheres in colorectal cancer. [score:1]
Both SKBR3/PR and MCF-7/PR cells were transfected with miR-451 mimics, and the cell apoptosis was analyzed using flow cytometry. [score:1]
The tumor size in the miR-451 antagomir group was much larger than those in the NC antagomir group (Figure 10a, left panel). [score:1]
A highly conserved sequence was displayed that was complementary to the ‘seed sequence’ of miR-451 and was identified within the YWHAZ 3′-UTR. [score:1]
These results together suggested the functional significance of miR-451 and support enhanced efficiency of miR-451/si-YWHAZ combination in vitro. [score:1]
In summary, these data suggested that miR-451 might play a critical role in cell migration and invasion in BC progression. [score:1]
Consistently, the mean weight of the tumors extracted from the miR-451 agomir group was lower than that of the NC agomir group (Figure 10b, right panel). [score:1]
The miR-451 response element (wild type or mutated) in the 3′-UTR of YWHAZ was amplified by PCR and cloned into pMIR-REPORT (Ambion, Austin, TX, USA) with firefly luciferase. [score:1]
In addition, expression of YWHAZ mRNA and miR-451 exhibited a significant inverse correlation as calculated by Pearson correlation in BC patients (r=−0.2226, P<0.0001) (Figure 4b). [score:1]
Role of miR-451 in modulating paclitaxel resistance in vivo. [score:1]
Synergistic effect of combined miR-451 and YWHAZ-siRNA. [score:1]
We also noticed an inverse correlation between miR-451 and YWHAZ in BC in vitro and in vivo. [score:1]
As shown in Figure 3b, SKBR3/PR and MCF-7/PR cells transfected with miR-451 mimics showed a reduction of cells in S phase (from 23.6 to 18.5% for SKBR3/PR, from 40.9 to 23.1% for MCF-7/PR), whereas the percentage of cells in the G0/G1 phases increased (from 40.1 to 54.1% for SKBR3/PR, from 33.4 to 40.6% for MCF-7/PR). [score:1]
As shown in Figure 10a (right panel), in the SKBR3/PR xenograft mo del, mice that received intratumoral injection of miR-451 agomir, the tumor size was significantly smaller than that of the negative control (NC) agomir group. [score:1]
To further refine these correlations and to determine the functional consequences of this combination, we performed in vitro cell migration and invasion analysis after miR-451 mimics/si-YWHAZ treatment in both PR cells. [score:1]
[1 to 20 of 79 sentences]
4
[+] score: 168
Other miRNAs from this paper: hsa-mir-451a, mmu-mir-451a, mmu-mir-451b
To determine whether intratumoral miR-451 administration affected the expression of factors in the PI3K/AKT signaling pathway, the expressions of CAB39, LKB1, AMPK, p-AMPK, PI3K and p-AKT were tested and were found to show significant downregulation in an immunohistopathological examination (Fig. 5C). [score:8]
We further analyzed the signaling pathway miR-451 might regulate in human glioma and found that miR-451 modulated the expression of multiple downstream molecules such as LKB1, AMPK, PI3K and AKT, suggesting that miR-451 may act as a tumor-suppressor factor and regulate the PI3K/AKT pathway through LKB1 and AMPK. [score:7]
Consistently, over -expression of miR-451 led to a marked downregulation of factors upstream of AKT. [score:6]
Although the reported under -expression of miR-451 in some types of tumors suggested a role in cancer development, the underlying mechanism is still unclear because little is known about the miR-451 target genes. [score:6]
Consistently, over -expression of miR-451 led to a marked down-regulation of LKB1, AMPK, p-AMPK, and PI3K, all of which are involved in the pathway upstream of AKT (Fig. 4A). [score:6]
miR-451 was down-regulated in glioma tissues and a significant negative correlation was revealed between miR-451 expression and glioma WHO grades. [score:6]
For a second prediction of possible hsa-miR-451 (human miR-451) gene targets we used MicroCosm Targets (http://microrna. [score:5]
However, using the STRING proteins functional association network database, AKT1 was shown to have a direct association with AKTIP and YWHAZ and an indirect association with CAB39, all three of these genes were predicted to be hsa-miR-451 target genes (Fig. 1). [score:5]
These data suggest that the tumor suppressor activity of miR-451 in glioblastoma cells likely acts through its regulation of the PI3K/AKT pathway. [score:4]
Previous data from our laboratory showed that miR-451 had a significant impact on cell proliferation, invasion and apoptosis in human glioblastoma cell lines, possibly by regulating AKT expression (18). [score:4]
Therefore, the identification of miR-451-regulated targets is a necessary step to understand how miR-451 functions. [score:4]
Quantitative real-time PCR showed that miR-451 expression increased in U251, LN229, A172, and U87 cells by 340.14, 849.22, 1680.88 and 2033.85-fold respectively after transfection with the miR-451 mimics, compared to its expression in the control and scramble treated cells (Fig. 3A). [score:4]
It is possible that hsa-miR-451 interacts indirectly with AKT1, through its target genes. [score:4]
The expression of miR-451 decreased markedly in high grade gliomas (WHO grades III and IV) compared to its expression in low grade gliomas (WHO grades I and II). [score:4]
Previously we have shown that miR-451 expression was negatively correlated with glioma WHO grades in quantitative real-time PCR and in situ hybridization. [score:3]
miR-451 inhibited the growth of LN229 glioblastoma cells in vivo. [score:3]
Expressions of mature miR-451 were quantified by miR-qRT PCR using the Hairpin-it™ miRNA qPCR Quantitation kit (GenePharma Co. [score:3]
Previous studies in our laboratory have shown a negative correlation between miR-451 and the expressions of AKT1 and c-Myc (18). [score:3]
miR-451 target gene(s) identification. [score:3]
org) to search for candidate miR-451 target genes and found 14 (YTHDF2, ZNF644, CUGBP2, C11orf30, FMNL3, FBXO33, AKTIP, VAPA, RKHD2, SAMD4B, OSR1, TTN, CAB39, YWHAZ). [score:3]
analysis revealed that miR-451 was expressed in gliomas and its total positive rate was 94.67% (71/75). [score:3]
miR-451 expression was negatively correlated with the WHO grades of gliomas. [score:3]
Increasing the expression of miR-451 might be a useful therapeutic strategy for treating glioma in the future. [score:3]
CAB39 is a target gene of miR-451 in glioma. [score:3]
As shown (Fig. 2A and B), miR-451 expression decreased with the increasing WHO grades of glioma tissues. [score:3]
Together, these data demonstrated that CAB39 is a target gene of the miR-451 in glioma. [score:3]
We used a three-step consequential approach to identify miR-451 target genes. [score:3]
Analysis of hsa-miR-451 candidate target genes. [score:3]
Both the STRING and KEGG databases indicated that CAB39 was the preferential candidate target gene of hsa-miR-451. [score:3]
miR-451 target gene confirmation. [score:3]
The transfected cells were used in subsequent Western blot assays and CAB39 was found to be significantly downregulated in cells treated with the hsa-miR-451 mimic oligonucleotide. [score:3]
In this study, we confirmed the hypo -expression of miR-451 in gliomas using quantitative real-time PCR and fluorescent in situ hybridization. [score:3]
This evidence, both in vitro and in vivo, implied that miR-451 can suppress cell proliferation in human glioma through the LKB1/AMPK and PI3K/AKT pathway. [score:3]
de/STRING/) (19), to explore possible interactions between the 14 candidate miR-451 target genes and AKT1 and c-Myc. [score:3]
Studies have shown that miR-451 inhibited cell growth (3), proliferation, and invasion and enhance apoptosis (18). [score:3]
Bioinformatics analysis failed to identify AKT1 and/or c-Myc as hsa-miR-451 target genes. [score:3]
To further study the biological role of miR-451 in human glioma tissues, we examined miR-451 expression in normal brain tissues, glioma tissues and glioma cell lines by quantitative RT-PCR. [score:3]
To exploit the possible interactions that were identified between the miR-451 target genes and AKT1 and c-Myc we used the KEGG pathway database (http://www. [score:3]
The calcium binding protein 39 gene (CAB39) predicted by bioinformatics analysis as a target gene of the miR-451, was validated by fluorescent reporter assay. [score:2]
Using this assay, we demonstrated that CAB39 was a target gene of miR-451. [score:2]
miR-451 regulated PI3K/ATK pathway factors in human glioma in vitro. [score:2]
As shown in Fig. 4B, obvious activation of phosphorylated-AKT was observed in U251, LN229, A172 and U87 cells after transfection with the miR-451 mimics. [score:1]
Indeed, 22/22 low grade gliomas exhibited detectable levels of miR-451, while in 4/53 high grade gliomas miR-451 was at detectable levels (p<0.05) (Fig. 2C). [score:1]
When the tumors were approximately 5 mm in length, the mice were randomly divided into 3 groups (10 mice per group): the LN229 control group, the LN229 scramble PBS -treated group, and the LN229 miR-451 -treated group. [score:1]
hsa-miR-451 is located on chromosome 17q11.2, a region known to be amplified in certain types of cancers, in close proximity to ERBB2 (17q12) (16, 17). [score:1]
Tumors in the group treated with miR-451 maintained a slow growth rate throughout the experiment while tumors in the control group began to grow faster. [score:1]
The probes (miR-451 10 ng) were added to the sections on the microarray and incubated overnight at 40°C in a water bath. [score:1]
A mixture of 5 μl oligonucleotides containing scramble miR-451 mimics and 10 μl Lipofectamine was injected into the xenograft tumor mo del in a multi-site injection manner. [score:1]
The sequences of the LNA/DNA oligonucleotides contained locked nucleic acids at five consecutive centrally located bases (indicated by the underline) as shown: HSA-miR-451 5′- TTGAG TCATT ACCAT TGCCA AA-3′. [score:1]
Though the exact molecular mechanisms for glioma genesis remain unclear, recent studies have reported that there were several microRNA (miRNA or miR) abnormalities in human gliomas, including miR-451 (3). [score:1]
To further understand the anti-tumor effect of miR-451 and its role in the signaling pathway in vivo, we employed an LN229 xenograft glioma mouse mo del. [score:1]
The oligonucleotide sequence of the hsa-miR-451 mimics was: 5′-AAACCGUUACCAUUACUGAGUU-3′. [score:1]
miRNA-451 was one of them. [score:1]
Transfections with hsa-miR-451 mimics were performed in serum-free medium 24 h after plating, with Lipofectamine 2000 (Invitrogen). [score:1]
Finally, to further evaluate the possibility of AKT1 and c-Myc as hsa-miR-451 target genes we used RNAhybrid (http://bibiserv. [score:1]
During the first 3 days of observation following intratumoral administration of miR-451, tumors in both the control and treated groups grew slowly with no marked differences in tumor size between them. [score:1]
A tumor suppressive role of miR-451 was shown in gliomas in vitro (18), but whether or not miR-451 actually participated in gliomagenesis still needs further investigation. [score:1]
At the termination of the study, the difference in tumor mass between the miR-451 treated group and the control group was marked (p<0.01). [score:1]
[1 to 20 of 58 sentences]
5
[+] score: 166
Other miRNAs from this paper: hsa-mir-21, hsa-mir-155, hsa-mir-451a
The mRNA and protein expression of CAB39 was obviously inhibited in miR-451 group compared with miR-NC group, and its expression was distinctly upregulated in anti-miR-451 group relative to anti-miR-NC group (P < 0.01, Figure 5(c), qRT-PCR; Figure 5(d), Western blot). [score:9]
Overexpression of miR-451 resulted in a promoted cell viability and invasion, whereas decreased expression of miR-451 led to inhibited cell viability and invasion, promoted cell apoptosis, and induced cell cycle arrest. [score:7]
Moreover, miR-451 exhibits a tumor-suppressive function in human glioma cells via inhibition of cell invasion and the expression of related protein [35]. [score:7]
Moreover, some researchers suggested that miR-451 promoted mTORC1 activation by suppressing the expression of CAB39 and resulted in the suppression of LKB1 activity and its downstream substrate AMPK activation [21, 22]. [score:7]
In this study, our data confirmed that miR-451 can directly target the 3′UTR of CAB39 and regulate the expression of CAB39 conversely. [score:7]
The results revealed that overexpression of miR-451 induced downregulation of CAB39 (pcDNA3 + miR-451 mimics group) can be rescued by transfection of pcDNA3/CAB39 (Figure 6(a)). [score:6]
The expression of miR-451 in cells transfected with miR-451 mimics was upregulated almost 4-fold in PANC-1 cells and 6-fold in AsPC-1 cells, whereas anti-miR-451 group decreased almost 60% (P < 0.05, Figures 2(a) and 2(b)). [score:6]
Bioinformatic analysis with TargetScan showed that CAB39 is a potential target of miR-451. [score:5]
Studies have provided evidence that miR-451 is involved in the progression of tumors through promotion of mTORC1 activation and miR-451 suppresses the expression of calcium -binding protein 39 (CAB39) in human glioma [22, 36]. [score:5]
The ultradeep sequencing profiles with high-throughput SOLiD identified a downregulated miR-451 in human gastric cardia [20]. [score:4]
These results indicated that CAB39 was the functional target of miR-451 and miR-451 regulated pancreatic tumor cells viability and invasion via CAB39. [score:4]
CAB39 Is the Direct Target of miR-451 in PANC-1 Cells. [score:4]
Moreover, increased expression of miR-451 (pcDNA3 + miR-451 mimics group) induced cell viability and invasion can be rescued by overexpression of CAB39 (pcDNA3/CAB39 + miR-451 mimics group) compared with corresponding controls (pcDNA3 + miR-NC) (P < 0.05, Figures 6(b) and 6(c)). [score:4]
In conclusion, our results showed that miR-451 promoted cell viability and invasion through downregulation of CAB39. [score:4]
Thus, our results demonstrated that miR-451 can directly target CAB39 via binding to its 3′UTR sequence. [score:4]
However, the effect of miR-451 on cells is contradictory as Tsuchiya found that miR-451 contributed to the formation of basolateral polarity in epithelial cells while Bandres validated the fact that miR-451 was inhibited in colorectal cancer tissues. [score:3]
The expression of miR-451 in cells (PANC-1 and AsPC-1 cells) transfected with miR-451/anti-miR-451 or controls was confirmed by qRT-PCR. [score:3]
The quantification of the miR-451 expression in tumor tissues and cells was carried out using SYBR Premix Ex Taq TM II kit (TaKaRa, Otsu, Shiga, Japan) on the Applied Biosystems 7500 Real-time PCR system (Life Technologies, USA). [score:3]
The Effect of miR-451 Can Be Rescued by Overexpression of CAB39. [score:3]
The cell cycle data indicated that the inhibition of miR-451 (anti-miR-451) induced G1/G2 arrest. [score:3]
The results suggested the expression of miR-451 was significantly promoted in the tumor tissues and cells relative to the normal adjacent samples and cells (P < 0.05, Figures 1(a) and 1(b)). [score:3]
The expression of miR-451 was intimately linked with metastasis and poor prognosis in PC patients. [score:3]
The expression level of miR-451 is also repressed in the serum of renal cell carcinoma patients with the sensitivity of 81%, specificity of 83%, and AUC of 0.86 [34]. [score:3]
Particularly, recent studies suggest that miR-451 promotes glioma cell proliferation but reduces cell migration via targeting calcium -binding protein 39 (CAB39) through monophosphate-activated protein (AMPK) signaling pathway [21]. [score:3]
In the present study, we investigated the potential roles of miR-451 in human pancreatic cancer cell lines and our findings suggested that miR-451 potentially targets CAB39 and elevated expression of miR-451 significantly promotes cell proliferation and invasion in pancreatic cancer cells. [score:3]
Overexpression of miR-451 Is Related to Poor Prognosis. [score:3]
These results represented that the inhibition of miR-451 decreased the invasive ability of pancreatic tumor cell. [score:3]
Three weeks later, we harvested the tumors and detected the miR-451 expression in the tumors. [score:3]
The result showed that patients with an elevated miR-451 expression were more frequently associated with tumor invasion and metastasis (Figure 1(d)). [score:3]
We further conducted Kaplan-Meier curves based on miR-451 levels in patient specimens tending to explore the relationship between the expression of miR-451 and patients prognosis (Figure 1(c)). [score:3]
All these data show that miR-451 is involved in various tumor developments through different regulation behavior and the exact role of miR-451 in tumorigenesis remains to be studied. [score:3]
As shown in Figure 3(a) inhibition of miR-451 (anti-miR-451) resulted in significant promoted cell apoptosis (11.33% in PANC-1 cells and 26.45% in AsPC-1 cells) compared with the control (anti-miR-NC) (P < 0.05). [score:2]
MiR-451 Suppresses Apoptosis and Blocks Cell Cycle Progression in PC Cells. [score:2]
In the present study, we found that miR-451 was overexpressed in the pancreatic cancer tissues and four pancreatic cancer cell lines (PANC-1, AsPC-1, BxPC-3, and SW1990) compared to the normal adjacent tissues and normal cell line (HPNE cell). [score:2]
To further identify whether miR-451 regulating cell invasion and proliferation was mediated by CAB39, we cotransfected pcDNA3/CAB39 or pcDNA3 and miR-451 mimics or miR-NC into PANC-1 cells. [score:2]
We further performed Fluorescent Reporter Assay to predict the potential target of miR-451. [score:2]
The mutation of miR-451 binding site was shown Figure 5(a). [score:2]
Lentivirus was conducted by triple transfection of PANC-1 cells with 4  µg of miR-451/miR-NC and 4  µg of lentiviral vector using lipid transfection (Lipofectamine-2000/Plus Reagent, Invitrogen). [score:1]
We next aim to explore the role of miR-451 in tumorigenesis in vivo. [score:1]
Since the effect of miR-451 on PC cell viability and invasion was mediated by CAB39, we next aimed to study the role of CAB39 in PC tissues and cells. [score:1]
As shown in Figure 3(b) the percentage of PANC-1 cells in G0/G1 phase increased from 23.55% to 48.74% while cells in S phase significantly decreased from 73.12% to 50.65% in the cells transfected with anti-miR-451. [score:1]
3 × 10 [4] cells (PANC-1 cell) were cultured in triplicate in 24-well plates the day before transfection, followed by cotransfection of CAB39-3′-UTR-WT/CAB39-3′-UTR-Mut and miR-451/anti-miR-451 or miR-NC/anti-miR-NC at indicated concentration with Lipofectamine 2000. [score:1]
The microarray analysis reveals that miR-451 is increased in plasma of gastric cancer patients and decreased in postoperative samples which can be used as blood -based biomarkers for gastric cancer screening [33]. [score:1]
PNAC-1 cells transfected with LV-miR-451 or LV-NC were injected into the flank of nude mice. [score:1]
Briefly, 10 [6] cells were seeded the day before and then cotransfected with miR-451 mimics (50 nM)/anti-miR-451 (100 nM)/si-CAB39 (100 nM) or corresponding control, respectively, which will be subjected to Western blot/qRT-PCR analysis at indicated time. [score:1]
MiR-451 is identified to control the regulation of glioma cell proliferation and migration through LKB1- AMPK signaling in glioblastoma [20, 32]. [score:1]
We employed four human pancreatic cancer cells (PANC-1, AsPC-1, BxPC-3, and SW1990) and normal pancreatic cells (HPNE cell) to investigate the expression patterns of miR-451 and CAB39 in pancreatic carcinoma cells. [score:1]
The miR-451 mimics, anti-miR-451, si-CAB39, and their corresponding controls (miR-NC, anti-miR-NC, and si-NC) were purchased from Shanghai GenePharma (Shanghai, China). [score:1]
Briefly, the cells (PANC-1 and AsPC-1 cells) were transfected with miR-451 mimics/anti-miR-451 or corresponding controls (miR-NC and anti-miR-NC), respectively, and incubated for 48 h. After transfection, 10  μl of 1x MTT was add to each well and subsequently incubated for another 4 h at 37°C. [score:1]
These data revealed that miR-451 may be involved in the carcinogenesis of pancreatic carcinoma. [score:1]
BALB/c nude mice (number 30; 4-5 weeks old) were purchased and randomly divided into two groups (Lv-miR-451 and Lv-NC) to test the function of miR-451 in vivo. [score:1]
We employed qRT-PCR to investigate the expression pattern of miR-451 in pancreatic cancer tissues and cells. [score:1]
Moreover, elevated miR-451 contributed to the promotion of tumor growth in nude mice. [score:1]
Studies conducted on miR-451 have provided evidence that miR-451 plays crucial role in diagnosis of human cancers including gastric cancer, colorectal cancer, and renal cell carcinoma [18– 20]. [score:1]
The MTT data indicated that the viability of miR-451 group was significant increased whereas the viability of anti-miR-451 group was significant decreased (in PANC-1 cells) comparing to corresponding controls (P < 0.05, Figure 2(c)). [score:1]
MiR-451 is found to play vital role in diagnosis of human cancer; however the regulation behavior is always complicated. [score:1]
Cell suspension (200  μl, 2-3 × 10 [5] cells/ml) was collected and add to upper chamber of Transwell filters (8  μm; Millipore, Boston, Massachusetts, USA) after transfection with anti-miR-451 or anti-miR-NC. [score:1]
Moreover, we analyzed the association of metastasis and miR-451. [score:1]
Consistent with this, the percentage of AsPC-1 cells (anti-miR-451 group) at G0/G1 phase increased from 19.23 to 48.26%, while the cells (anti-miR-451 group) in S phase decreased from 67.38% to 48.23%. [score:1]
All these findings support that miR-451 promotes cell viability in vitro and in vivo. [score:1]
[1 to 20 of 60 sentences]
6
[+] score: 118
These data indicate that miR-140 and miR-451 were able to downregulate luciferase expression by targeting the UTR sequences of var and therefore imply that both miR-140 and miR-451 can downregulate the expression of var group A genes and that miR-451 can also downregulate the expression of var group B genes. [score:18]
Among these genes, miR-451 and miR-140 target the mRNA of a critical parasite antigen, PfEMP1, and downregulate its expression. [score:8]
Among these miRNAs, miR-451 and miR-140 targeted the mRNAs of a critical parasite antigen, P. falciparum erythrocyte membrane protein-1 (PfEMP1), and downregulated its expression. [score:8]
Our data showed different efficacy of miR-451 in hemoglobin (Hb) AA RBCs from a previous report, [16] in which miR-451 in heterozygous HbAS or HbSS erythrocytes was covalently integrated into P. falciparum mRNAs essential for parasite growth, suppressing the translation of one of these transcripts, a cAMP -dependent protein kinase PKA-R, and inhibiting the parasite blood stage development. [score:8]
Since the expression of PfEMP1 offers the parasite advantages in vivo, but not in vitro, the downregulation of PfEMP1 caused by miR-451 and miR-140 is unlikely to affect parasite development during in vitro culture, indicating that the function of human miRNAs against parasites is more complicated. [score:7]
[12] In addition, it has been discovered that, in RBCs of sickle cell anemia patients, human miR-451 and let-7i are highly enriched, both of which are capable of targeting the mRNAs of malaria parasites to inhibit their translation. [score:7]
In addition, miR-451 downregulates the var gene of parasite virulence factor PfEMP1, which could moderate pathological injury due to the disease. [score:6]
39, 40, 41, 42, 43 Our data demonstrated for the first time that human miR-451 and miR-140 can recognize the 5′ or 3′UTR of var genes at the transcriptional level, effectively downregulating the expression of the luciferase reporter. [score:6]
Luc-A exhibited significantly increased luciferase activity when co -transfected with a miR-140 inhibitor, whereas Luc-B and Down-A exhibited significantly decreased luciferase activity when co -transfected with a miR-451 mimic, in spite of inconsistent effects with miR-140 mimic and miR-451 inhibitors, possibly due to the interference of endogenous miRNAs in 293ET cells (Figure 4A). [score:5]
In contrast to a control var group C gene PF3D7_0400400, both PF3D7_0712000 (var group A gene) and PF3D7_0800100 (var group B gene) could be downregulated by miR-140 and miR-451, respectively, although the regulation efficiency of the miR-140 mimic did not reach significance (Figure 4B). [score:5]
48, 49, 50 In studies of the mechanism of miRNA expression in human erythropoiesis, an abundant amount of miR-451 has been demonstrated in enucleated normal RBCs and 10 [4]-fold more miR-451 is expressed in RBCs than in granulocytes. [score:5]
Taken together, our data suggest that, by mediating the transfer of hAgo2-miRNA complexes into iRBCs, host-derived miR-451 and miR-140 play a crucial role in regulating var gene expression during the blood stage of malaria infection. [score:4]
The sequences of miR-451 and miR-140 mimics or inhibitors are listed in Supplementary Table S4. [score:3]
Among these miRNAs, we chose miR-451 and miR-140 for further studies because they were predicted to target the UTR of var genes (Supplementary Table S5), which encodes 60 homologs of PfEMP1 protein, a critical molecule in the adherence of iRBCs to the endothelium of host blood vessels in malaria patients. [score:3]
Given that the co-evolution of Plasmodium parasites with great apes and humans has been estimated to have been continuing for more than a million years, 53, 54 it is tempting to speculate that this miR-451 inhibition is an inherited genetic feature passed down from primate ancestors as a genetic memory. [score:3]
Approximately 200 μL of cells at 50% hematocrit were electroporated with 10 μg of synthesized FAM-conjugated miR-451/-140 mimics, inhibitors or negative control oligonucleotides as described previously. [score:3]
For luciferase assay, one constructed vector (Luc-A/-B/-C/Down-A) or a site-mutated vector (Luc-A [mut]/-B [mut]/Down-A [mut]) mixed with Renilla luciferase vector was added to the wells in triplicate and was co -transfected into 293ET cells with/without miR-451/-140 mimics or inhibitors (synthesized by Invitrogen Corp. [score:2]
51, 52 However, the reason why a large amount of miR-451 exists in RBCs has not yet been clearly determined. [score:1]
To confirm the quantitative variation of miR-451 in vivo, we infected mice with P. yoelii parasites. [score:1]
In this study, we investigated the cargo transfer ability of RBC-derived MPs during in vitro culture of the asexual erythrocytic stages of P. falciparum, attempted to identify the miRNA complexes within the MPs, and studied the effects of two miRNAs, miR-451 and miR-140, on the expression of P. falciparum var genes. [score:1]
However, one of the most notable observations in this study was that iMPs include much more miR-451 than nMPs. [score:1]
Our results confirm the localization of miR-451 in parasites (Figure 3B), which is consistent with the findings of recent studies. [score:1]
To further examine the localization of hmiRNAs, we used miR-451, one of the most abundant hmiRNAs identified by RIP-Seq with high read counts (Supplementary Table S6), as a marker to perform fluorescence in situ hybridization in the parasite. [score:1]
In an in vivo rodent mo del, we detected increased levels of miR-451 in the RBCs of P. yoelii-infected mice. [score:1]
By virtue of our experiments confirming that miR-451 is involved in the resistance of blood stage malaria infection and the results from Chi’s group that transfection of HbAA erythrocytes with miR-451 markedly reduces parasitemia, [16] we think that miR-451 has the potential to be developed as a new therapeutic drug for malaria infection, especially in the treatment of cerebral malaria. [score:1]
[16] The miR-451 levels appeared to be higher in iMPs than in nMPs (Figure 3C, left). [score:1]
RT-qPCR showed that, after infection, mouse miR-451 (Mmu-miR-451) levels were significantly higher in iRBCs than in nRBCs, even at different levels of parasitemia (Figure 3E). [score:1]
Furthermore, in both nMPs and iMPs, we identified mature human miRNAs, such as miR-451, miR-486 and miR-181a, by RT-qPCR and stem-loop RT-PCR (Figure 3C, left). [score:1]
Also, much higher miR-451 levels were found when iMPs were added to the iRBCs than when they were added to the nRBCs. [score:1]
[47] MiR-451, an erythroid-specific miRNA, is an example in both erythropoiesis and in anemia linked to malaria. [score:1]
29, 30 As miR-451 had the highest read count, we chose to use it as a marker, finding that it was present inside iRBCs, iMPs and nMPs. [score:1]
Surprisingly, the results from RT-qPCR and northern blot analysis showed that the level of miR-451 was at least twofold higher in iRBCs than in nRBCs (Figure 3C, right), which are the same patterns as those in MPs; however, no such significant changes were seen for miR-486 and miR-181, which provided evidence that miR-451 is apparently exchanged between nRBCs and iRBCs via some specific conveyors. [score:1]
After co-culturing nMPs or iMPs with synchronized ring stage iRBCs for 24 h, both nMPs and iMPs could increase the level of miR-451 in iRBCs in a dosage -dependent manner (Figure 3D, left); the highest level was from the group of iMPs plus iRBCs when incubating for 16 h (Figure 3D, right). [score:1]
The cover slips were incubated overnight with hybridization buffer containing 5′ FAM-labeled miR-451 probe (Genepharma, Shanghai, China) complementary to miR-451. [score:1]
[1 to 20 of 34 sentences]
7
[+] score: 110
The downregulation of miR451 target proteins, induced by MV-HLSC, was abrogated when HepG2 were transfected with anti-451 miRNA inhibitor. [score:8]
When HepG2 were transfected with the miRNA inhibitor, anti-miR451, MVs were unable to downregulate the MDR1 expression, suggesting that miR451 transferred by MVs was biologically active. [score:8]
The most convincing results were obtained with inhibitors of miR31 and 223 that were downregulated also in MV DCR− as well as with the inhibitor of miR451, that has been previously described as a Dicer independent miRNA [56]. [score:8]
Supporting Information Figure 3B shows that MDR1, MIF, and RAB14, targeted by miR451, and E2F-2, targeted by miR31, were overexpressed at RNA level in HepG2 with respect to hepatocytes. [score:7]
We also observed that the HepG2 stimulation with MV-HLSC induced a downregulation of two other important miR451 targets, MIF and RAB14 (Fig. 5D) [40, 41]. [score:6]
Transfection of HepG2 with anti-miR451 (anti-miR451+MV) but not with anti-CTR abrogated the target downregulation induced by MV-HLSC. [score:6]
HepG2 stimulation with MV-HLSC induced a downregulation of MIF and RAB14, previously shown to be important miR451 targets [39, 40]. [score:6]
As shown in Figure 5D, MDR1, targeted by miR451 [40], was strongly expressed on HepG2 cell membrane. [score:5]
The prominent role of miR451 and miR31 transfer was indicated by the direct antitumor activity of miR451 and miR31 mimics on HepG2 that resulted in MDR1, MIF, RAB14, and E2F-2 downregulation similar to that of MV-HLSC. [score:5]
Treatment with anti-miR451 and anti-miR31 in the absence of MVs did not interfere with target expression by hepatoma tumors. [score:5]
In particular, we analyzed the involvement in MV-HLSC antitumor activity of miR31 and miR451, previously described as regulators of proliferation and as tumor suppressors in different cancer cells [35, 38, 39]. [score:4]
Their downregulation, induced by MVs, was abrogated when HepG2 were transfected with anti-miR451, but not with anti-CTR (Fig. 5D). [score:4]
Furthermore, HepG2 transfection with miR451 and miR31 mimics resulted in MDR1, MIF, RAB14, and E2F-2 downregulation similar to that of MV-HLSC (Fig. 5D, 5E). [score:4]
In mice treated with anti-miR451 and anti-miR31, the inhibition of tumor growth induced by MV-HLSC was significantly less effective than in animals treated with anti-CTR (Fig. 6, A– 6C). [score:3]
MVs from fibroblasts, used as control, contained significant less amount of tumor suppressive miR451, 223, and 31, than MV-HLSC (Fig. 3C). [score:3]
In Vivo Biological Effect of Anti-miR451 or Anti-miR31 Inhibitors. [score:3]
Transfection of HepG2 with anti-miR451 without MV treatment, did not affect MDR1 expression (data not shown). [score:3]
Moreover, the use of miRNA inhibitors against miR451, miR223, miR24, miR125b, and miR31 on HepG2 reduced the proapoptotic activity induced by MV-HLSC. [score:3]
As shown in Figure 3C, the content of tumor-suppressive miRNAs miR451, 223, and 31, in MVs from fibroblast used as control was significantly lower than that of MV-HLSC. [score:3]
The inhibitory effect of MV-HLSC was abrogated by anti-miR451 and anti-miR31 administration (Fig. 6E, 6F). [score:3]
Treatment with anti-miR451 without MV administration (anti-miR451) did not interfere with protein expression by HepG2. [score:3]
HepG2 transfection with miR451, miR31, and miR223 mimics, which reproduce mature endogenous miRNAs, inhibited proliferation of HepG2 (Fig. 5B). [score:3]
Moreover, the miR451 has been shown to regulate drug resistance to chemotherapeutics mediated by MDR1/P-glycoprotein [41]. [score:2]
Among miRNAs present in MV-HLSC, we detected several miRNAs with potential antitumor activity including miR451, miR223, miR24, miR125b miR31, and miR122 (Fig. 3A). [score:1]
The miR451 mimic mediated also a proapoptotic effect comparable to that of MV-HLSC (Fig. 5C). [score:1]
Among miRNAs present in MV-HLSC [10], several ones were associated with potential antitumor activity, such as miR451, miR223, miR24, miR125b, miR31, miR214, and miR122. [score:1]
This was more significant for miR451, miR223, and miR31. [score:1]
To evaluate whether single miRNAs with antitumor activity (miR451, miR223, miR24, miR125b, and miR31) were relevant for the proapoptotic effect of MV-HLSC, we transfected HepG2 with selected miRNA inhibitors (Fig. 5A). [score:1]
[1 to 20 of 28 sentences]
8
[+] score: 97
Other miRNAs from this paper: hsa-mir-451a, hsa-mir-517a, hsa-mir-517b
From the top five highly expressed placental miRNAs, we demonstrated that miR-451 and miR-720 were highly expressed in normal human placenta and several other normal tissues, but were downregulated in cancer cell lines. [score:8]
miR-451 and miR-720 are highly expressed in normal human placenta and normal tissues but downregulated in cancer cell lines. [score:6]
Cells overexpressing miR-451 or miR-720 for 48h were harvested using TrypLE Express enzyme (ThermoFisher Scientific, Waltham, MA USA) and plated sparsely into 6-well plates (500 cells/well). [score:5]
miR-451 and miR-720 were expressed in normal tissues, including placenta, but downregulated in cancer cell lines as compared to normal samples, suggesting that both miRNAs could be important to the maintenance of the normal phenotype in placenta cells and normal tissues. [score:5]
miR-451 expression was also observed in several human normal tissues, presenting equal or higher expression levels in comparison to the normal placenta (Figure 2A). [score:5]
Using miRNA mimics, we overexpressed miR-451 or miR-720 (Figure 3A and 3B) in a cancer cell line derived from choriocarcinoma (JEG3) and a colon adenocarcinoma cell line (HT-29), both expressing low levels of those miRNAs (data not shown). [score:5]
In this report, we demonstrated that miR-451 and miR-720 highly expressed placental miRNAs, presented very low or undetectable expression in cancer cell lines when compared to the normal placenta and other normal tissues. [score:4]
Additionally, we observed that overexpression of miR-451 or miR-720 dramatically decreased cell migration in both cell lines (Figure 5A). [score:3]
Among the top-five most highly expressed miRNAs in normal human placenta, we evaluate the expression of miR-451, miR-517a, miR-517b and miR-720 in normal human placenta samples, several normal human tissues and different cancer cell lines using RT-qPCR. [score:3]
Future studies are necessary to gain further mechanistic insights into miR-451 and miR-720 role in tumorigenesis and assess if these findings can be translated to clinical application. [score:3]
Our data demonstrated that miR-451 or miR-720 ectopic expression impaired cell proliferation in both JEG3 and HT-29 cancer cell lines (Figure 4). [score:3]
Our results confirmed miR-451 and miR-720 elevated expression levels in all normal human placenta samples, corroborating the microarray data. [score:3]
Restoration of expression indicates a possible role for miR-451 and miR-720 in controlling proliferation, migration, and invasion at least in choriocarcinoma and colorectal cancer cells. [score:3]
The ectopic expression of miR-451 or miR-720 was performed in cancer cell lines JEG3 (choriocarcinoma) and HT-29 (colon adenocarcinoma). [score:3]
Additionally, ectopic expression of miR-451 or miR-720 in choriocarcinoma cell line (JEG3) or colon adenocarcinoma cell line (HT-29) resulted in impaired cell proliferation, decreased cell migration and reduced ability of colony formation in both cells lines. [score:3]
MiR-451 was suggested as a tumor suppressor as it has been associated with the regulation of several biological processes, including cell proliferation, migration, invasion and treatment response in glioblastoma [24, 25], colorectal carcinoma [26, 27] and lung cancer cell lines [28, 29]. [score:3]
JEG3 cells also had their invasion ability impaired upon overexpressed miR-451 or miR-720 (Figure 5B). [score:3]
Scientific literature regarding miR-451 and miR-720 expression in human placenta is scarce. [score:3]
However, miR-451 and miR-720 elevated expression in human placenta samples has already been demonstrated in previous studies [15]. [score:3]
Graphic representation of miR-451 or miR-720 mimic expression in cancer cell lines JEG3 (A) and HT-29 (B). [score:3]
Figure 3Graphic representation of miR-451 or miR-720 mimic expression in cancer cell lines JEG3 (A) and HT-29 (B). [score:3]
Additionally, the differential expression of miR-451 was related with placenta undergoing hypoxic conditions [23]. [score:3]
Furthermore, colony formation assay demonstrated that miR-451 or miR-720 overexpression significantly reduced the ability of both JEG3 and HT-29 cells to establish colonies after twelve days of culturing (Figure 5C). [score:2]
MiR-451 low expression was also associated with cell survival and resistance to hormone therapy in patients with breast carcinoma [30, 31] and with the progression and worse prognosis in osteosarcoma [32, 33]. [score:2]
JEG3 and HT-29 cells (1 × 10 [5] cells/200 μL serum free medium) were seeded in the upper chambers of the transwell inserts 48 h after transfection with mimics for miR-451 or miR-720 or negative control. [score:1]
Figure 5Cell migration, invasion and colony formation ability after miR-451 or miR-720 mimic transfection. [score:1]
Graphic representation of miR-451 (A) and miR-720 (B) normalized expression evaluated by RT-qPCR. [score:1]
CTRL: parental cancer cell line transfected with irrelevant miRNA mimic (miRIDIAN mimic negative control); miR-451: cancer cell line transfected with miR-451 mimic; miR-720: cancer cell line transfected with miR-720 mimic. [score:1]
CTRL: parental cancer cell line transfected with the irrelevant miRNA mimic (miRIDIAN mimic negative control); miR-451: cancer cell line transfected with miR-451 mimic; miR-720: cancer cell line transfected with miR-720 mimic. [score:1]
Together, our data indicate a possible role for miR-451 and miR-720 in controlling proliferation, migration, and invasion at least in choriocarcinoma and colorectal cancer cells. [score:1]
miR-451 and miR-720 control key biological processes in cancer cell lines. [score:1]
Mann-Whitney statistical test; [*] p < 0.05. after miR-451 or miR-720 mimic transfection. [score:1]
Figure 2Graphic representation of miR-451 (A) and miR-720 (B) normalized expression evaluated by RT-qPCR. [score:1]
Cell index value was acquired at 24, 48, 72 and 96 h. CTRL: parental cancer cell line transfected with the irrelevant miRNA mimic (miRIDIAN mimic negative control); miR-451: cancer cell line transfected with miR-451 mimic; miR-720: cancer cell line transfected with miR-720 mimic. [score:1]
[1 to 20 of 34 sentences]
9
[+] score: 80
Differentially expression type microRNA name Mean ratio Up-regulated hsa-miR-193b 2.1165 hsa-miR-34a 3.1282 hsa-miR-100 2.3189 hsa-miR-4485 2.6155 Down-regulated hsa-miR-3690 0.4276 hsa-miR-124 0.3538 hsa-miR-183 0.3946 hsa-miR-3935 0.3999 hsa-miR-451 0.4126 hsa-miR-4538 0.3603 hsa-miR-4701 0.4249 Figure 1 Hierarchical clustering analysis between 5 SALS patients and 5 healthy controls based on differentially expressed miRNAs. [score:11]
Differentially expression type microRNA name Mean ratio Up-regulated hsa-miR-193b 2.1165 hsa-miR-34a 3.1282 hsa-miR-100 2.3189 hsa-miR-4485 2.6155 Down-regulated hsa-miR-3690 0.4276 hsa-miR-124 0.3538 hsa-miR-183 0.3946 hsa-miR-3935 0.3999 hsa-miR-451 0.4126 hsa-miR-4538 0.3603 hsa-miR-4701 0.4249 Figure 1 Hierarchical clustering analysis between 5 SALS patients and 5 healthy controls based on differentially expressed miRNAs. [score:11]
In the present study, we observed down-regulation of hsa-miR-451 in our SALS and PD patients, suggesting that the miRNA might be a biomarker for neurodegenerative diseases, which was not specific to SALS. [score:6]
Previous studies found that the miR-451, which was differentially expressed in several diseases, such as multiple myeloma (Du et al., 2015), epithelial ovarian cancer (Ling et al., 2015), and central nervous system malignancies (Drusco et al., 2015), could represses cell proliferation and invasion (Zeng et al., 2014). [score:5]
A functional network (Figure 4 and Supplementary Table 1 [miRNAs-pathways]), based on Gene Ontology and KEGG database, was constructed to visualize the connections of hsa-miR-183, hsa-miR-193b, hsa-miR-3935, and their predicted targets (hsa-miR-451, which target genes were less and failed to construct the pathway net, was rule out). [score:5]
Combining the expression of these four miRNAs in PD, the results suggested that hsa-miRNA-183 might be a specific biomarker for SALS, whereas hsa-miR-451 and hsa-miR-3935 might be common biomarkers linked to neurodegenerative diseases, such as ALS and PD. [score:5]
miR-451 inhibits invasion and proliferation of bladder cancer by regulating EMT. [score:4]
Interestingly, the down-regulation of hsa-miR-451 was also found in leukocytes from Italian ALS patients (De Felice et al., 2012). [score:4]
In SH-SY5Y neuron-like cells, downregulation of miR-451 had neurotrophic, neuroprotective, anti-Oxidant, and anti-apoptotic effects (Alural et al., 2014). [score:4]
EPO Mediates Neurotrophic, Neuroprotective, Anti-Oxidant, and Anti-Apoptotic Effects via Downregulation of miR-451 and miR-885-5p in SH-SY5Y Neuron-Like Cells. [score:4]
The expression of hsa-miR-451 and hsa-miR-3935 were significantly lower in PD patients than those in SALS and controls. [score:3]
The significant differences in the expression levels of four miRNAs (hsa-miR-183, hsa-miR-193b, hsa-miR-451, and hsa-miR-3935) were confirmed between the SALS patients and HCs (Figure 2). [score:3]
Expression and prognostic significance of microRNA-451 in human epithelial ovarian cancer. [score:3]
These miRNAs, including hsa-miR-183, hsa-miR-193b, hsa-miR-451, and hsa-miR-3935, were down regulated in SALS patients relative to healthy controls, with AUC values of 0.69, 0.62, 0.81, and 0.57, respectively. [score:2]
Seven miRNAs with significantly lower expression levels, including hsa-miR-3690, hsa-miR-124, hsa-miR-183, hsa-miR-3935, hsa-miR-451, hsa-miR-4538, and hsa-miR-4701, were identified in the SALS group compared with HCs (mean ratio = 0.35–0.43, p < 0.05, Table 2, Figure 1). [score:2]
In the present study, we observed significantly lower expression of hsa-miR-183, hsa-miR-193b, hsa-miR-451, and hsa-miR-3935 in SALS patients compared with controls. [score:2]
In summary, our pilot study showed that peripheral blood leukocytes miR-183, miR-193b, miR-451, and miR-3935 are down regulated in SALS, which raises the potential clinical utility of leukocytes miRNA profiling in SALS diagnosis. [score:2]
MicroRNA-451 regulates stemness of side population cells via PI3K/Akt/mTOR signaling pathway in multiple myeloma. [score:1]
The ROC curve analyses revealed that the levels of hsa-miR-183, hsa-miR-193b, hsa-miR-451, and hsa-miR-3935 were useful biomarkers for the diagnosis of ALS, with AUC values of 0.763 [95%CI: 0.677–0.835], 0.713 [95%CI: 0.624–0.792], 0.820 [95%CI: 0.740–0.884], and 0.590 [95%CI: 0.497–0.679], respectively. [score:1]
The four miRNAs were combined as a panel of miRNAs by the logit mo del, which was used to construct the ROC curve as follow, logit (p = SALS) = 3.152 − 0.708 × hsa-miR-193b − 1.517 × hsa-miR-183 − 0.147 × has-miR-3935 − 3.331 × hsa-miR-451. [score:1]
ROC curve analyses revealed that the plasma levels of hsa-miR-183, hsa-miR-193b, hsa-miR-451, and hsa-miR-3935 were useful biomarkers for differentiating SALS and HCs, with AUC values of 0.763, 0.713, 0.820, and 0.590, respectively. [score:1]
[1 to 20 of 21 sentences]
10
[+] score: 80
Expression of miR-451 in P. berghei-infected mouse erythrocytesIn addition to Homo sapiens, miR-451 is also expressed in other species, such as Mus musculus, Rattus norvegicus, Danio rerio, Xenopus tropicalis, Gallus gallus, and Mono delphis domestica [26]. [score:5]
The association between miR-451 expression level and the development of erythrocyte-stage P. falciparum. [score:4]
In this study, the expression of miR-451 in the blood of KM mice was confirmed by (Figure 3). [score:3]
Further analysis of miR-451 expression and malaria infection showed no association between the accumulation of miR-451 in Plasmodium falciparum-iRBCs, the life cycle stage of P. falciparum in the erythrocyte, or of P. berghei in mice. [score:3]
However, a human miRNA, miR-451, was highly expressed, comprising approximately one third of the total identified miRNAs. [score:3]
QZ carried out Northern blot of miR-451 expression. [score:3]
siRNAs: short interfering RNAs; RISC: RNA -induced silencing complex; iRBCs: infected red blood cells; ASO: antisense oligonucleotide; WBC: white blood cells; has: Homo sapiens;LNA: locked nucleic acids XX carried out the construction and analysis of small RNA library, participated in the analysis of miR-451 expression and drafted the manuscript. [score:3]
The weaker expression of miR-451 in higher parasitaemia, as detected by Northern blotting, is due to dilution of parasite RNAs, because this difference was abolished after adjusting the total RNAs loaded based on the number of blood cells. [score:3]
In addition, an ASO against miR-451, which normally inhibits miRNA activity [28- 30], had no observable effects on the growth of P. falciparum. [score:3]
The association between miR-451 expression and the parasite were analysed by Northern blotting and antisense oligonucleotide (ASO) of miR-451. [score:3]
Figure 2 Detection of expression of miR-451 by Northern blot. [score:3]
In addition to Homo sapiens, miR-451 is also expressed in other species, such as Mus musculus, Rattus norvegicus, Danio rerio, Xenopus tropicalis, Gallus gallus, and Mono delphis domestica [26]. [score:3]
The results showed that miR-451 expression, when comparing equivalent amounts of RNA, decreased slightly from lower to higher parasitaemia and became undetectable at 86% parasitaemia (Figure 3A). [score:3]
Figure 3Analysis of miR-451 expression in the blood of P. berghei-infected KM mice at different parasitaemias. [score:3]
Several potential explanations need to be addressed in future studies: (1) the ASO failed to diffuse into the RBCs, presumably due to their integration in the cell membrane of RBCs and the presence of nuclease in medium; (2) the accumulation of miR-451 to a very high level in RBCs abolished the inhibitory function of the ASO, even the ASOs that could enter the cells; (3) the lower affinity of the locked nucleic acid (LNA/DNA) miR-451 ASO might influence the formation of stable complexes with the blocking oligonucleotide [31]. [score:3]
When the parasitaemia in the mice reached approximately 10%, the blood was harvested for detecting expression of miR-451. [score:3]
The data presented here showed that accumulation of miR-451 in RBCs is unrelated to the life cycle of P. falciparum in the erythrocytic stage and parasitaemia in vivo, which suggested that the miR-451 expressed at high levels in RBCs is independent of parasite infection. [score:3]
So the relationship between malaria infection and the expression of miR-451 were further explored. [score:3]
Expression of miR-451 in P. berghei-infected mouse erythrocytes. [score:3]
To investigate the association between the expression level of miR-451 and parasite development, the transcription of miR-451 at different development stages of synchronized P. falciparum-infected RBCs was assayed by Northern blot. [score:2]
To further analyse the potential functions of miR-451 in the development of erythrocyte-stage parasites, the Plasmodium-infected RBCs were synchronized and cultured in RPMI-1640 medium containing an ASO of miR-451 (Sangon, Shanghai, China)[22]. [score:2]
The anti-miR-451 LNA oligonucleotide 5'-aaActCagTaaTggTaaCggTtt-3' (uppercase: LNA; lowercase: DNA) was complementary to the mature miR-451 sequence. [score:1]
Biotin-labeled miR-451 was used as a hybridization probe. [score:1]
Synthesis and administration of miR-451 antisense oligos (ASO). [score:1]
The investigation whether the expression of miR-451 could be influenced by Plasmodium infection in vivo was performed by using the P. berghei (ANKA strain) mice mo del. [score:1]
The human miR-451 accumulated at a very high level, comprising almost 1/3 of the identified miRNAs isolated from P. falciparum-iRBCs (Table 1). [score:1]
This indicated that the weak signal of the miR-451 transcript in samples with higher parasitaemia was due to dilution of parasite RNAs. [score:1]
After incubating with different concentrations of the miR-451 ASO for 72 hr, thin blood smears were prepared to determine parasitaemia of each sample by counting the number of parasites in 2,000 erythrocytes. [score:1]
Moreover, when total RNA from equivalent numbers of erythrocytes was loaded, there was also no significant difference among them, although the transcription level of miR-451 seemed slightly lower in the next generation (cultivated after 72 h) (Figure 2B). [score:1]
Moreover, treatment with an antisense oligonucleotide to miR-451 had no significant effect on the growth of the erythrocytic-stage P. falciparum. [score:1]
In addition, the miR-451 accumulation in Plasmodium-infected RBCs is independent of parasite infection. [score:1]
confirmed the abundance of miR-451 in Plasmodium-infected RBCs. [score:1]
Different concentrations of the miR-451 ASO were added to the cultures and parasitaemias were determined. [score:1]
The result showed that miR-451 was transcribed at a very high level in P. falciparum-iRBCs, whereas no miR-451 transcripts were observed in human WBCs (Figure 2A). [score:1]
However, if the total RNAs loaded were adjusted based on the number of blood cells, the difference in miR-451 transcript level disappeared (Figure 3B). [score:1]
To eliminate the possibility that the accumulated miR-451 in P. falciparum-iRBCs were derived from contamination by human white blood cells (WBCs), the transcription of miR-451 in parasite-iRBC and human WBCs was analysed by Northern blot. [score:1]
Notably, the miRNA miR-451 accumulated to a very high level in infected RBCs, comprising more than one third of the cloned miRNAs. [score:1]
[1 to 20 of 37 sentences]
11
[+] score: 60
However, above reports did not show the reduced plasma expression of miR-17, miR-451, miR-106a, and miR-19b in disease groups, suggesting the downregulation of four-miRNA panel is specific for FSGS and may be involved in the pathogenesis of FSGS. [score:8]
a-d The expression of miR-17, miR-451, miR-106a, and miR-19b between in FSGS patients (n = 74) and in other chronic kidney diseases including 69 IgAN patients, 24 MSPGN patients, and 26 MN patients. [score:5]
Figure  5c showed miR-17, miR-451, and miR-106a were significantly downregulated in FSGS with proteinuria (n = 56) when compared with FSGS patients who were in remission (urinary protein <400 mg/24 h after treatment) (n = 18), whereas the expression of miR-19b did not differ in above two groups. [score:5]
Zhang Z MicroRNA-451 regulates p38 MAPK signaling by targeting of Ywhaz and suppresses the mesangial hypertrophy in early diabetic nephropathyFEBS Lett. [score:5]
Fig. 4 a Expression of miR-17, miR-451, miR-106a, and miR-19b in plasma of FSGS (n = 50) and healthy controls (n = 68). [score:3]
MiR-451 has been demonstrated to inhibit glomerular mesangial cell proliferation by regulating p38 MAPK signaling in diabetic nephropathy [22]. [score:3]
Fig. 3 a Expression of miR-17, miR-451, miR-106a, and miR-19b in plasma of FSGS (n = 24) and healthy controls (n = 35). [score:3]
a Expression of miR-17, miR-451, miR-106a, and miR-19b in plasma of FSGS (n = 50) and healthy controls (n = 68). [score:3]
Here, we found four-plasma miRNAs (miR-17, miR-451, miR-106a, and miR-19b) were significantly downregulated in FSGS compared with healthy controls. [score:3]
A schematic of the study outlining the independent patients and samples used in discovery, training, validation, and blinded-test phases of the identification of plasma-miRNA panel for FSGS miRNA profiling in plasma from five FSGS patients and five healthy controls was performed by using a real-time PCR -based high-throughput miRNA array a Expression of miR-17, miR-451, miR-106a, and miR-19b in plasma of FSGS (n = 24) and healthy controls (n = 35). [score:3]
In this study, we found the expression of the three-miRNA panel, including miR-17, miR-451, and miR-106a was associated with complete remission of FSGS. [score:3]
We found that the expression of miR-17, miR-451, and miR-19b was significantly lower in medium-severe FSGS compared with mild FSGS (Fig.   5a). [score:2]
In current study, we found that the expression of plasma miR-17, miR-451, and miR-19b was significantly lower in medium-severe FSGS compared with mild FSGS. [score:2]
results showed that the levels of miR-17, miR-451, miR-106a, and miR-19b were the lowest in FSGS patients compared with healthy controls and disease controls. [score:2]
e ROC analysis of three-miRNA panel including miR-17, miR-451, and miR-106a for discriminating FSGS remission. [score:1]
miR-17, miR-451, and miR-106a were related to FSGS remission. [score:1]
Logistic regression demonstrated that a linear combination of values for miR-17, miR-451, miR-106a, and miR-19b produced the best mo del for FSGS diagnosis. [score:1]
As shown in Fig.   3b, the areas under ROC curves (AUCs) of miR-17, miR-451, miR-106a, and miR-19b were 0.66 (95% confidence interval (CI), 0.52–0.80), 0.66 (95% CI, 0.51–0.80), 0.70 (95% CI, 0.56–0.84), and 0.72 (95% CI, 0.59–0.86), respectively. [score:1]
ROC curve analysis showed that miR-17 had AUC of 0.61 (95% CI, 0.51–0.72), miR-451 had AUC of 0.76 (95% CI, 0.67–0.85), miR-106a had AUC of 0.64 (95% CI, 0.54–0.74), and miR-19b had AUC of 0.72 (95% CI, 0.62–0.82) (Fig.   4b). [score:1]
As a result, four-plasma miRNAs (miR-17, miR-451, miR-106a, and miR-19b) were the ones which fulfilled above criteria and then selected for further validation. [score:1]
A three-miRNA panel, including miR-17, miR-451, and miR-106a had AUC of 0.71 (95% CI, 0.55–0.86) (P  < 0.01) (Fig.   5e). [score:1]
ROC curve analysis showed that miR-17 had AUC of 0.65 (95% CI, 0.50–0.80), miR-451 had AUC of 0.66 (95% CI, 0.50–0.81), and miR-106a had AUC of 0.69 (95% CI, 0.53–0.85) (Fig.   5d). [score:1]
The fold changes in miR-17, miR-451, miR-106a, and miR-19b were 0.55, 0.56, 0.59, and 0.55, respectively (Fig.   3a). [score:1]
For example, significant positive correlations were found between miR-17 and miR-451, and between miR-106a and miR-19b plasma levels, with correlation coefficient values of 0.773 and 0.843, respectively (P  < 0.001) (Figure  S3). [score:1]
[1 to 20 of 24 sentences]
12
[+] score: 52
1: hsa-miR-451 gene expression; 2a: Spp1 gene expression; 2b: Ang gene expression In order to explore the biological significance of the Spp1 and Ang genes, their expression in normal and elevated P endometrium were analyzed by imunohistochemistry methods. [score:9]
The Sanger Database-predicted mRNA gene targets of miR-451 were then cross-referenced against the 22 mRNA genes; indeed, it was shown that miR-451 gene targets were differentially expressed between normal and elevated P endometrium genes from the Affymetrix microarray expression analysis. [score:9]
A total of 4 down-regulated miRNAs demonstrated statistically significant differential expression between the control, normal P, and elevated P groups (fold change < 0.2); this implies that four miRNAs exhibited a relative decreased expression (hsa-miR-451, hsa-miR-424, hsa-miR-125b, and hsa-miR-30b; Figure 1 and Table 2). [score:8]
In an effort to further explore the biologic relationship between reduced receptivity and identified miRNA, a search of the Sanger Database for predicting mRNA targets of the miR-451 (the most differentially expressed, fold change = 0.12) was conducted. [score:5]
Four of 22 (18%) differentially expressed genes, Tyr (tyrosinase precursor), Usp16 (ubiquitin carboxyl-terminal hydrolase 16), Galk2 (N-acetylgalactosamine kinase), and Spp1 (osteopontin precursor) were also predicted mRNA targets of miR-451. [score:5]
reactions were performed using miRNA and mRNA specific primers for miRNA-451 (miR-451), the lowest expression of miRNA, Spp1, and Ang expression. [score:4]
Using the Sanger database, 4 of the 22 mRNA genes were identified as predicted targets of the miRNA-451; several of these mRNA genes are associated with endometrial receptivity. [score:3]
Figure 3Validation of hsa-miR-451, Spp1, and Ang gene expression between the groups. [score:3]
miRNA-451, Spp1, and Ang expression in RT-PCR verified the array results. [score:3]
Spp1 was one of the 4 miR-451 regulated genes. [score:2]
Sequence (5'-3') Length Amplicon size (bp) miR-451 hsa-miR-451RT:GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACaactcaAS: GCGAAACCGTTACCATTACTGA Spp1 NM_000582R:TGGGGTCTACAACCAGCATAF:ACATCTTTGCGTTTTCTACCG2020 103 Ang NM_001145R:CTGTGGTTTGGCATCATAGTGF:CATGTACGTTGCTATCCAGGC2121 264 After deparaffinizing sections, the section slides were rehydrated in steps with distilled water (dH2O); slides were immersed in 0.5% v/v hydrogen peroxide/methanol for 10 minutes. [score:1]
[1 to 20 of 11 sentences]
13
[+] score: 45
Expression of miR-451 is highly expressed in skeletal muscle [55] and is up-regulated in low responders to endurance resistance in humans [36]; however, the effect of human exercise or animal grazing on the circulating miR-451 level has not yet been studied. [score:8]
TargetScan predicted 22 genes including titin as the targets of the only up-regulated c-miRNA, miR-451; however, no significant gene ontology (GO) or KEGG pathway terms were obtained. [score:8]
In the present study, miR-451 expression in the BP muscle of the grazing cattle was temporarily up-regulated at 2 mo compared to the housed cattle, which suggests the positive effect of grazing on miR-451 expression in skeletal muscles, as well as on miR-206 and miR-208b [16]. [score:7]
Since the expression level of miR-451 in skeletal muscle cells is associated with myogenesis [34], ageing [35], and exercise [36], the miR-451 expression in muscle during grazing was analyzed. [score:5]
Synchronous miR-451 expression was also observed in skeletal muscle, which might result in secretion or intake of the miRNA between circulation and tissue cells in the grazing cattle. [score:3]
In addition, the higher circulation level of miR-451 might reflect a response for erythroid maturation [56] to supply more oxygen against increased movement, as shown in the restricted expression of miR-451 to erythropoietic cells in mice and human. [score:3]
Of these c-miRNAs, circulation levels of miR-19b, miR-148a, miR-150, miR-221, miR-223, miR-320a, miR-361, and miR-486 were significantly down-regulated in the grazing cattle compared to housed cattle, whereas the miR-451 level was higher in the grazing than in the housed cattle. [score:3]
In this overview, it was noted that the only miRNAs that were observed to increase in the grazing but not in the housed cattle were miR-144 and miR-451, whereas there were many more miRNAs with an increasing tendency in the housed but not in the grazing, such as miR-150 and miR-223. [score:1]
Also present were miR-1777b (6.71%), miR-1777a (4.88%), miR-1246 (4.42%), miR-126-3p (2.44%), miR-2305 (2.07%), miR-1584-5p (1.90%), miR-2413 (1.74%), miR-4286 (1.58%), miR-1224 (1.56%), and miR-451 (1.41%). [score:1]
Intriguingly, the miR-451 level in the BP muscle of the grazing cattle at 2 mo was also higher than that in the housed (P = 0.008; Fig 6B). [score:1]
Intriguingly, this change synchronized with the higher level of circulating miR-451 in the grazing than in the housed cattle. [score:1]
Changes in levels of 9 plasma exosomal miRNAs (A) and muscular miR-451 (B) of grazing and housed cattle analyzed by qRT-PCR. [score:1]
The potential role of miR-451 in cancer diagnosis, prognosis, and therapy. [score:1]
Among the miRNAs tested, miR-451 was unique in that the circulation level in the grazing cattle was higher than in the housed cattle at 2 mo (P = 0.044). [score:1]
According to the results, the increased level of circulating miR-451 might be caused by the release of the increased intramuscular miR-451. [score:1]
[1 to 20 of 15 sentences]
14
[+] score: 44
Our network analysis demonstrated that the increased expression of miR-223 and miR-451 could lead to upstream inhibition of G-protein GNA11, and in turn down-regulation of the ion channel regulator KCNMA1 and muscle contractile gene MYOM1 via a tyrosine-protein kinase SRC and NF-κB signaling (Fig 3). [score:9]
In SIP tissues, miR-223 and miR-451 were up-regulated and their potential target genes KCNMA1, GNA11, MYOM1 were down-regulated compared with Surg-CTL tissues (Table 3). [score:8]
miR-451 targeting CPNE3 and RAB5A, [25] and miR-141 targeting CXCL12B [26] have known functions on leukocyte chemotaxis and migration [26]. [score:5]
In contrast, upregulation of miR-451 and miR-223 in SIP suggested modulation of G-protein -mediated muscle contraction. [score:4]
In SIP tissues, the regulation of miRNA/mRNA pairs, including miR-223/ KCNMA1, miR-451/ GNA11 and miR-451/ MYOM1 indicated involvement of these miRNAs in dysregulating the muscle contraction pathway, a major pathologic mechanism associated with SIP [4]. [score:3]
Expressions of miR-451 and GNA11 were also significantly and inversely correlated. [score:3]
Our results showed that levels of miRNA/mRNA pairs: miR-451/ TLR4, miR-4793-3p/ TLR4, miR-132/ HBEGF, miR-1290/ THBS1, miR-132/ CD44, miR-223/ ICAM1, miR-132/ MMP9, miR-146-3p/ GNA11 and miR-146-3p/ MYLK were significantly correlated in an inverse manner in NEC tissues, whereas miR-410/ FLT-1 was directly correlated (Fig 2). [score:2]
A proposed network of dysregulated miRNA/mRNA pairs in NEC suggested interaction at bacterial receptor TLR4 (miR-31, miR-451, miR-203, miR-4793-3p), mediated via key transcription factors NFKB2 (miR-203), AP-1 /FOSL1 (miR-194-3p), FOXA1 (miR-21-3p, miR-431 and miR-1290) and HIF1A (miR-31), and extended downstream to pathways of angiogenesis, arginine metabolism, cell adhesion and chemotaxis, extracellular matrix remo deling, hypoxia/oxidative stress, inflammation and muscle contraction. [score:2]
In the current study, miR-451 was inversely correlated with TLR4, and could also regulate arginine hemostasis (OAT) and G-protein mediated muscle contraction (GNA11). [score:2]
More importantly, other dysregulated miRNAs observed in our study, such as miR-451, miR-1290, miR-4725-3p, miR-4793-3p, miR-431 and miR-203, have not been previously reported in other inflammatory intestinal conditions. [score:2]
In SIP tissues, miR-451/ GNA11 was inversely correlated. [score:1]
Alternatively, specific miRNAs such as miR-146b-3p and miR-451 could be utilized to enhance intestinal muscular function in NEC and SIP. [score:1]
miR-223 and miR-451 have known functions on proliferation and differentiation of vascular and skeleton muscles, [27, 28] but their novel involvement in neonatal gut muscle physiology and SIP pathophysiology has not been reported previously. [score:1]
Yet, their levels were inversely correlated within same NEC samples such as miR-451/ TLR4 (receptor), miR-4793-3p/ TLR4 (receptor), miR-132/ HBEGF (angiogenesis), miR-1290/ THBS1 (angiogenesis), miR-132/ CD44 (adhesion/chemotaxis) and miR-132/ MMP9 (ECM remo deling). [score:1]
[1 to 20 of 14 sentences]
15
[+] score: 40
Therefore, we measured the expression of GRP78 mRNA, rno-miR-144, rno-miR-376a, and rno-miR-451 using real-time RT-PCR to examine their expression patterns in the context of LHR downregulation (Fig. 1). [score:6]
In a similar manner, rno-miR-144 and rno-miR-376a expression peaked 12 h after the hCG treatment, and rno-miR-451 expression peaked 24 h after the hCG treatment. [score:5]
We believe that the discrepancy regarding in the expression of miR-144 and 451 between in the in vivo and in vitro experiments (Fig. 1 and 2) can be explained by the presence of blood cells in the in vivo study which express both rno-miR-144 and rno-miR-451 [22], [23]. [score:5]
uk/) revealed that rno-miR-144, rno-miR-376a, and rno-miR-451 can bind to the 3′-UTR of GRP78 mRNA (from bp 2439–2459) and negatively regulate GRP78 expression. [score:4]
Rat GRP78 mRNA, rno-miR-144, rno-miR-376a, and rno-miR-451 expression in primary rat granulosa cells induced by FSH and hCG. [score:3]
Time course of rat GRP78 mRNA, rno-miR-144, rno-miR-376a, and rno-miR-451 expression in rat ovaries induced by PMSG and hCG. [score:3]
The array data along with the bioinformatic analysis provided by MicroCosm Targets, which indicated that several miRNAs bind to the GRP78 mRNA 3′-UTR, led us to focus on rno-miR-144, rno-miR-376a, and rno-miR-451. [score:3]
From these, we narrowed the focus to rno-miR-376a based on the results of the in vitro experiments (Fig. 2) since rno-miR-144 and rno-miR-451 was not induced expression by hCG treatment. [score:3]
In contrast, rno-miR-144 and rno-miR-451 expression decreased significantly after the hCG treatment. [score:3]
Rat GRP78 mRNA (A), rno-miR-144 (B), rno-miR-376a (C), and rno-miR-451 (D) expression levels were measured using real-time RT-PCR as described in the. [score:1]
The amount of rat GRP78 mRNA, rno-miR-144, rno-miR-376a, and rno-miR-451 in the hCG 0 h group was set at 1. Data were normalized to 18S rRNA (for GRP78 mRNA) and 4.5S RNA(H) (for rno-miR-144, rno-miR-376a, and rno-miR451) levels in each sample and represent the mean ±SE of three independent experiments. [score:1]
Total RNA was isolated, and GRP78 mRNA (A), rno-miR-144 (B), rno-miR-376a (C), and rno-miR-451 (D) expression levels were measured using real-time RT-PCR as described in the. [score:1]
Next, we investigated the effects of rno-miR-144, rno-miR-376a, and rno-miR-451 on GRP78 mRNA expression in granulosa cells isolated from DES -treated immature rats (Fig. 2). [score:1]
The amounts of GRP78 mRNA, rno-miR-144, rno-miR-376a, and rno-miR-451 in the hCG 0 h group were set at 1. Data were normalized for 18S rRNA (for GRP78 mRNA) and 4.5S RNA(H) (for rno-miR-144, rno-miR-376a, and rno-miR-451) levels in each sample and represent the mean ±SE of 3 independent experiments. [score:1]
[1 to 20 of 14 sentences]
16
[+] score: 36
Focusing on the conserved miRNAs presented in Table 1, we found that of the 14 miRNAs downregulated in our study relative to normal bone, six were published as upregulated in osteosarcoma relative to osteoblasts, namely the miRNAs miR-126, miR-142-3p, miR-195, miR-223, miR-451 and miR-497, while miR-31/miR-31* was upregulated compared to bone and downregulated compared to osteoblasts. [score:11]
The inverse deregulation of miRNAs compared to bone or osteoblasts is consistent with previous publications, Jones et al. [10] identified miR-126, miR-142-5p, miR-195, miR-223 and miR-451 to be downregulated in osteosarcoma versus bone while Lulla et al. [11] reported a subset of these, miR-126, miR-142-3p, miR-223 and miR-451, to be upregulated when compared to osteoblasts. [score:6]
miR-451 and miR-497 showed a trend towards being significantly decreased, miR-31 showed a heterogenous expression pattern, and miR-19b, miR-29b and miR-142-3p were expressed at comparable level in clinical samples and bone. [score:5]
Among these, miR-126/miR-126*, miR-142-3p, miR-150, miR-223, miR-486-5p and members of the miR-1/miR-133a, miR-144/miR-451, miR-195/miR-497 and miR-206/miR-133b clusters were found to be downregulated in osteosarcoma cell lines. [score:4]
The highly downregulated miRNAs presented in Table 1 were miR-126/miR-126*, miR-142-3p, miR-150, miR-223, miR-363, miR-486-5p and members of the miR-1/miR-133a, miR-206/miR-133b, miR-451/miR-144 and miR-497/miR-195 clusters. [score:4]
Similar modes of regulation have been described for miR-126/miR-126*, miR-223 and miR-451 in erythroid differentiation (reviewed in [34], [35]. [score:2]
A set of miRNAs, miR-1, miR-18a, miR-18b, miR-19b, miR-31, miR-126, miR-142-3p, miR-133b, miR-144, miR-195, miR-223, miR-451 and miR-497 was identified with an intermediate expression level in osteosarcoma clinical samples compared to osteoblasts and bone, which may reflect the differentiation level of osteosarcoma relative to the undifferentiated osteoblast and fully differentiated normal bone. [score:2]
miR-144 was undetected in all osteoblasts, and miR-1 and miR-451 was undetected in two and three of the osteoblast samples, respectively. [score:1]
As predicted, the 13 miRNAs miR-1, miR-18a, miR-18b, miR-19b, miR-31, miR-126, miR-133b, miR-142-3p, miR-144, miR-195, miR-223, miR-451 and miR-497 showed opposite regulation when the osteosarcoma clinical samples were compared against bone or osteoblasts. [score:1]
[1 to 20 of 9 sentences]
17
[+] score: 36
The down-regulation of miR-451 suggests that its pro-proliferation mRNA targets may not be inhibited in meningioma grades I and II. [score:8]
miR-451 is considered a tumor suppressor that inhibits proliferation and invasion by regulating epithelial-to-mesenchymal transition (EMT) in bladder cancer [56] and hepatocellular carcinoma [57]. [score:5]
We observed strong down-regulation (−10/−18 fold, SOLiD/RT-qPCR) of miR-451 in meningiomas. [score:4]
Zeng T. Peng L. Chao C. Fu B. Wang G. Wang Y. Zhu X. miR-451 inhibits invasion and proliferation of bladder cancer by regulating EMT Int. [score:4]
After verification of the top 18 miRNAs by RT-qPCR with fold change values over ±5.17 in any of these comparisons, only six miRNAs (miR-21, miR-34a, miR-143, miR-193b, miR-218, and miR-451) were clearly differentially expressed (tumors vs. [score:3]
Also, miR-451 differential expression was reported in meningioma by microarray analysis in another study [43]. [score:3]
The differential expression of miR-218, miR-34a and miR-451 in meningiomas were previously reported, using microarray analysis [48]. [score:3]
It should be noted that the differential expression between grades I and II observed in deep sequencing in a few miRNAs (miR-21, miR-34a, miR-376, miR-451 and miR-99a) were not verified in RT-qPCR (Table 2 and Table 3). [score:3]
Our results indicate that meningioma tumor formation and proliferation in part could be attributed to the lower expression of miR-143, miR-193b and miR-451, a feature similar to that of several malignant tumors. [score:3]
[1 to 20 of 9 sentences]
18
[+] score: 31
To confirm the time dependence of estrogen effect on miRNA expression in NZB/W [F1] mice, we analyzed the expression of miR-223 and miR-451, which were markedly upregulated by estrogen in wild-type B6 mice [42]. [score:8]
The expression of miR-223 and miR-451 in splenocytes was not increased with lupus manifestation in NZB/W [F1] mice (Figure S1) and the diversity in the expression level of select lupus -associated miRNAs in estrogen -treated mice with lymphoma development (Figure S2). [score:6]
Figure 5 Estrogen increased the expression of miR-223 and miR-451 expression in splenocytes from NZB/W [F1 ] mice. [score:5]
As expected, the expression levels of miR-223 and miR-451 were significantly upregulated in both 10-wk-old (Figure  5A) and 32-wk-old (Figure  5B) estrogen -treated mice when compared to age-matched intact or placebo -treated mice. [score:5]
Unlike lupus -associated miRNAs such as the miR-182 cluster that was highly increased in diseased, 36–40-wk-old NZB/W [F1] mice [34], miR-223 and miR-451 were not significantly increased in 36–40-wk-old female NZB/W [F1] mice when compared to pre-diseased NZB/W [F1] or NZW control (Additional file 1: Figure S1). [score:4]
The graphs show increased miR-223 and miR-451 expression in splenocytes from 10-wk-old (A) and 32-wk-old (B) estrogen -treated orchidectomized NZB/W [F1] mice when compared to either age-matched placebo control or intact control mice. [score:2]
This suggests that the remarkable increase of miR-223 and miR-451 in 32-wk-old estrogen -treated mice was attributable to estrogen effect, but not to lupus manifestation. [score:1]
[1 to 20 of 7 sentences]
19
[+] score: 30
Among these 17 miRNAs, 7 miRNAs (hsa-miR-130b*, hsa-miR-21*, hsa-miR-223, hsa-miR-302a, hsa-miR-424, hsa-miR-451, hsa-miR-486-5p) were differentially expressed between active TB and latent TB, 6 miRNAs were up-regulated in active TB patients, and only hsa-miR-130b* showed reduced gene expression level. [score:8]
Interestingly, 5 of the miRNAs (hsa-miR-365, hsa-miR-223 and hsa-miR-144, hsa-miR-451, hsa-miR-424) were highly expressed in PBMCs and their expression in 3 groups was confirmed by qPCR. [score:5]
There were no detectable correlations between hsa-miR-451, hsa-miR-342-5p and their target genes, which may be due to the small quantity of target genes for these 2 miRNAs in database (Table 2). [score:5]
We analyzed the expression of 7 miRNAs (hsa-miR-223, hsa-miR-365 hsa-miR-424, and hsa-miR-451, hsa-miR-144, hsa-miR-500 and hsa-miR-21*) selected from the microarray data by qPCR. [score:3]
The expression profiles of the active TB and LTBI groups were statistically different for miRNAs from group 1: hsa-miR-144 (P<0.05), hsa-miR-424 (P<0.01), hsa-miR-451(P<0.05), hsa-miR-223 (P<0.05), and hsa-miR-365 (P<0.05). [score:3]
This difference between active and non-active TB groups was mainly due to the induced expression of hsa-miR-365, hsa-miR-223 and hsa-miR-302a, hsa-miR-486-5p, hsa-miR-144 and hsa-miR-451, hsa-miR-21* and hsa-miR-424 in active TB patients. [score:3]
Among these miRNAs, hsa-miR-223, hsa-miR-424, and hsa-miR-451 and hsa-miR-144 were highly expressed in PBMCs compared to other miRNAs. [score:2]
MiR-451, with its cluster miR144, is required for erythroid differentiation and homeostasis [34]. [score:1]
[1 to 20 of 8 sentences]
20
[+] score: 30
A comparison was performed between the miRNAs upregulated in both MMTBI and STBI group which identified a signature of 10 miRNAs viz miR-151-5p, miR-195, miR-20a, miR-328, miR-362-3p, miR-30d, miR-451, miR-486, miR-505* and miR-92a, with increased expression in both MMTBI and STBI groups (Fig. 2, Common miRNAs in MMTBI and STBI are highlighted in bold in Tables 1 and 2). [score:6]
Validation in CSF samples showed that expression of miR-328, miR-362-3p miR-486 and miR-451 was significantly upregulated, however; no significant elevation in levels of miR-151-5p, miR-30d and miR-20a was detected. [score:6]
MiR-505* and miR-451 were not predicted to target any of the target molecules for TBI in IPA. [score:5]
Normalization with miR-202 showed a significant upregulation of miR-328, miR-362-3p, miR-451 and miR-486 (Fig. 4). [score:4]
MiR-451 was reported to be upregulated in the cortex after a TBI in a mouse mo del 29. [score:3]
There were significant differences between the two groups for all but two of the selected miRNA: miR-195 (p < 0.001); miR-30d (p < 0.001); miR-451 (p < 0.011); miR-328 (p < 0.101); miR-92a (p < 0.001); miR-486 (p < 0.006); miR-505 (p < 0.008); and miR-362 (p < 0.035); miR-151 (p < 0.065); and miR-20a (p < 0.012) (Fig. 5). [score:1]
The real time data for miR-151-5p, miR-195, miR-20a, miR-30d, miR-328, miR-362-3p, miR-451, miR-486, miR-505* and miR-92a was normalized using miR-202. [score:1]
The analysis identified the AUC values as miR-195 (0.81, p value < 0.003), miR-30d (0.75, p value < 0.016), miR-451 (0.82, p value < 0.002), miR-328 (0.73, p value < 0.030), miR-92a (0.86, p value < 0.001), miR-486 (0.81, p value < 0.003), miR-505 (0.82, p value < 0.002), miR-362 (0.79, p value < 0.006), miR-151 (0.66, p value < 0.123), miR-20a (0.78, 0.007). [score:1]
The AUC’s were: miR-195 (0.81), miR-30d (0.75), miR-451 (0.82), miR-328 (0.73), miR-92a (0.86), miR-486 (0.81), miR-505 (0.82), miR-362 (0.79), miR-151 (0.66), miR-20a (0.78). [score:1]
There were significant differences between the two groups for all but two of the selected miRNA (see asterisks): miR-195 (p < 0.001); miR-30d (p < 0.001); miR-451 (p < 0.011); miR-328 (p = 0.101); miR-92a (p < 0.001); miR-486 (p = 0.006); miR-505 (p = 0.008); and miR-362 (p = 0.035); miR-151 (p = 0.065); and miR-20a (p = 0.012). [score:1]
Comparison of miRNAs modulated in this study with that of serum miRNA from blast induced MMTBI in rats show common miRNAs such as miR-20a, miR-362-3p, miR-195, miR-451 and miR-92a. [score:1]
[1 to 20 of 11 sentences]
21
[+] score: 28
TargetScan and PicTar analysis showed that miR-26a showed target for collagen type I and CTGF gene and miR-451 showed target for titin which are markers for pro-fibrotic process. [score:7]
0064396.g003 Figure 3 A. Expression of miR-1, miR-26a and miR-29c B. Expression of miR-34b, miR-451 and miR-1246. [score:5]
A. Expression of miR-1, miR-26a and miR-29c B. Expression of miR-34b, miR-451 and miR-1246. [score:5]
MiR-1, miR-26a, miR-29c, miR-34b, miR-451 and miR-1246 are downregulated in PH subjects. [score:4]
In contrast miR-451 and miR-1246 showed sharp declined expression in the male subjects (Fig. 5). [score:3]
The expressions of miR-26a, miR-29c, miR-451 and miR-1246 were declined to 0.66±0.12, 0.52±0.14, 0.49±0.16 (p<0.05) and 0.67±0.21-folds (p = ns) respectively, in moderate PH subjects, compared to the control subjects. [score:2]
We choose the following miRNAs for validation:MiR-21, miR-23a, miR-26a, miR-29, miR-34b, miR-191, miR-451 and miR-1246 were derived from the miRNA array analysis (Figure 2). [score:1]
We choose the following miRNAs for validation: MiR-21, miR-23a, miR-26a, miR-29, miR-34b, miR-191, miR-451 and miR-1246 were derived from the miRNA array analysis (Figure 2). [score:1]
[1 to 20 of 8 sentences]
22
[+] score: 27
Mir-451 has been reported to be downregulated in lung cancer, and in an inverse relationship with disease occurrence and development. [score:6]
Expression levels of mir-144 or mir-451 in tumor tissues were normalized to the expression of above microRNAs in the corresponding normal tissues from the same patient. [score:5]
0074175.g001 Figure 1 A and B. The relative expression levels of mir-144 and mir-451 in normal (n = 26) and tumor tissues (n = 26). [score:3]
Micro -RNA expression kits for mir451 (001105), mir144 (002676) and RUN48 (001006) were purchased from Applied Biosystems. [score:3]
As shown in Figure 1A and 1B, we found a significant down-regulation for both mir-144 (>70% decrease, p<0.001) and mir-451(>60% decrease, p<0.001) in non-small-cell lung cancer tissues (n = 26) as compared to the peri-tumoral normal tissues (n = 26), which is in line with previous data showing that mir-144 and mir-451 share the same DNA locus, coordinately transcribed and plays similar roles in various pathophysiological scenarios [13], [24], [35], [36]. [score:3]
A and B. The relative expression levels of mir-144 and mir-451 in normal (n = 26) and tumor tissues (n = 26). [score:3]
However there are several papers discerning the important function of mir-451, another microRNA sharing the same locus with mir-144, in the tumorigenesis and development of lung cancer [20]– [23]. [score:2]
Levels of mir-144 and mir-451 are decreased NSCLC tumor tissues comparing to peri-tumor normal tissues. [score:1]
Levels of mir-144 and mir-451 are decreased in NSCLC tumor tissues comparing to peri-tumor normal tissues. [score:1]
[1 to 20 of 9 sentences]
23
[+] score: 26
In THCA, only one up-regulated miR-221 was collected, and the further extension of down-regulated miR-451 was selected although it was identified as down-regulated miRNA without statistical significance in the male–THCA group (log [2]FC = -1.83, P [adj] = 0.6557). [score:10]
Some miRNAs were collected to understand the isomiR expression in LUSC, including down-regulated miRNAs (miR-451 and miR-30a) and up-regulated miRNAs (miR-205, miR-210, miR-183, and miR-9). [score:9]
In the miR-451 locus, except for the rate of most dominant and fourth dominant isomiRs, other rates differed, which also demonstrated that the miRNA locus could generate different isomiR expression profiles. [score:3]
The rate of the most dominant and secondary dominant isomiRs in miR-451 differed between normal and tumor samples in males and females, whereas other miRNA loci exhibited similar isomiR expression between normal and tumor samples (Table 2). [score:3]
Similarly, pairwise comparisons of isomiRs demonstrate that miR-30a and miR-221 diverged between genders; and miR-30a and miR-451 are diverged between normal and tumor samples (Table 2). [score:1]
[1 to 20 of 5 sentences]
24
[+] score: 25
Other miRNAs from this paper: hsa-mir-21, hsa-mir-375, hsa-mir-451a
In the present studied cohort of 62 MTC patients, we showed up-regulation of miR-375, -129, -10a, and down-regulation of miR-451 in tumor vs non-tumor tissues, overlapping with results produced by different previously published studies [20– 22, 37]. [score:7]
MiR-375 was the most up-regulated and miR-451 the most down-regulated. [score:7]
As expected, the validation set yielded over -expression of miR-375 and under -expression of miR-451 in tumor vs non-tumor tissues (Figure 1B). [score:5]
Quantitative real-time RT-PCR was performed for the validation set to check for the expression of the 2 selected miRNAs of interest (miR-375 and miR-451), according to the manufacturer's protocol (Applied Biosystems, SD, CA). [score:3]
Relative expression of miR-375 and miR-451 in tumor vs non-tumor tissue of 22 patients (11 HMTC, 11 SMTC). [score:3]
[1 to 20 of 5 sentences]
25
[+] score: 24
Importantly, both miR-451 and miR-709 directly repressed MYC expression and miR-709 also directly targeted the AKT and Ras-GRF1 oncogenes. [score:7]
MiR-451 and miR-709 have been shown to modulate MYC expression and also act as downstream targets of NOTCH1 in murine T-ALL [52]. [score:5]
Thus, miR-451 and miR-709 functioned as suppressors of oncogenesis within the NOTCH1/MYC regulatory axis of murine T-ALL. [score:4]
These repression effects were mediated by degradation of the E2A tumor suppressor followed by ICN1 induction, which transcriptionally activates the genes encoding miR-451 and miR-709. [score:3]
It was also demonstrated that decreased expression of miR-451 and miR-709 was necessary for initiation and maintenance of mouse T-ALL. [score:3]
In this study, activation of NOTCH1 signaling by induction of ICN1 led to repression of miR-451 and miR-709 in an established mouse mo del of T-ALL. [score:1]
The NOTCH1/miR-451/MYC axis also played a part in human T-ALL (only miR-451 has human homologue). [score:1]
[1 to 20 of 7 sentences]
26
[+] score: 24
In our microarray study, seven miRNAs were found to be differentially expressed, four (hsa-miR-196b, hsa-miR-30a, hsa-miR-873, and hsa-miR-337-3p) were downregulated and three (hsa-miR-1288, hsa-miR-451, and hsa-miR-223) were upregulated in EP pregnancy-derived tissues compared to VTOP samples. [score:8]
Four miRNAs (hsa-miR-196b, hsa-miR-30a, hsa-miR-873, and hsa-miR-337-3p) were found to be downregulated in EP versus healthy pregnancy tissues, and three miRNAs (hsa-miR-1288, hsa-miR-451, and hsa-miR-223) were upregulated in EP compared to control pregnancy tissue samples (Figure 1A). [score:6]
We observed a very significant increase (p<0.001) in the EP tissue samples compared to VTOP samples for hsa-miR-451(A) and hsa-miR-223 (B) expression, while hsa-miR-196b (D) showed a significant (p<0.05) downregulation compared to VTOP controls. [score:4]
As an initial approach to functionally studying the differential profile of the statistically different miRNAs identified in the EP and VTOP embryonic samples, we performed a computational analysis to identify the genes and pathways which might be modulated by the three differentially expressed miRNAs we had found: miR-196b, miR-223, and miR-451. [score:3]
We confirmed a significant (p<0.001) increase in hsa-mir-451 (Figure 2A) and hsa-mir-223 (Figure 2B) miRNA expression (p<0.05) in EP samples compared to VTOP control samples, which was an even higher increase than in our microarray study. [score:2]
Of these seven miRNAs, three of them (hsa-miR-196b, hsa-miR-223, and hsa-miR-451) were validated by real time PCR in a larger sample of EP and control tissues. [score:1]
[1 to 20 of 6 sentences]
27
[+] score: 24
However, ratios for miR-451 and miR-486-5p showed that expression levels were inverted, indicating significant up-regulation in sera, but down-regulation in tumor tissue. [score:9]
In addition to miR-451, -486-5p, and −100, two additional miRNAs were identified as significantly up-regulated in the low titer group (miR-25 and let-7b) both of which were also identified as significantly dysregulated in tumor tissue, although let-7b had been identified as down-regulated (Figure 5A). [score:8]
When these samples were compared to healthy controls, only three significantly dysregulated miRNAs were identified; miR-486-5p and miR-451 were up-regulated, and miR-100 was down-regulated (fold change ≥ 2, p ≤ 0.05) (not shown). [score:7]
[1 to 20 of 3 sentences]
28
[+] score: 24
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-25, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-198, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-142, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-362, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-382, hsa-mir-340, hsa-mir-328, hsa-mir-342, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-335, hsa-mir-345, hsa-mir-196b, hsa-mir-424, hsa-mir-425, hsa-mir-20b, hsa-mir-451a, hsa-mir-409, hsa-mir-484, hsa-mir-486-1, hsa-mir-487a, hsa-mir-511, hsa-mir-146b, hsa-mir-496, hsa-mir-181d, hsa-mir-523, hsa-mir-518d, hsa-mir-499a, hsa-mir-501, hsa-mir-532, hsa-mir-487b, hsa-mir-551a, hsa-mir-92b, hsa-mir-572, hsa-mir-580, hsa-mir-550a-1, hsa-mir-550a-2, hsa-mir-590, hsa-mir-599, hsa-mir-612, hsa-mir-624, hsa-mir-625, hsa-mir-627, hsa-mir-629, hsa-mir-33b, hsa-mir-633, hsa-mir-638, hsa-mir-644a, hsa-mir-650, hsa-mir-548d-1, hsa-mir-449b, hsa-mir-550a-3, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-454, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-708, hsa-mir-216b, hsa-mir-1290, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-3151, hsa-mir-320e, hsa-mir-378c, hsa-mir-550b-1, hsa-mir-550b-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
Some miRNAs, miR-203 and miR-451, inhibit ABL and BCR-ABL expression directly [40]. [score:6]
Low expression of miR-151-5p and miR-451, and high expression of miR-1290 or a combination of all three, predicted inferior relapse-free survival (RFS) in pediatric B-ALL [74]. [score:5]
In fact, ICN1 decreased expression of these miRNAs by promoting the degradation of the tumor suppressor E2A, which induced the transcription of miR-451 and miR-709. [score:5]
Consistent with this, repression of miR-451 and miR-709 expression was involved in the initiation and maintenance of mouse T-ALL [75]. [score:3]
Importantly, activation of NOTCH intracellular domain (NCID) signaling led to transcriptional repression of miR-451 and miR-709, two tumor suppressor microRNAs in T-ALL. [score:3]
Myc was directly repressed by both miR-451 and miR-709. [score:2]
[1 to 20 of 6 sentences]
29
[+] score: 24
Comparing the inhibition of luciferase activity by the lentiviral expressed and endogenously expressed miRNAs, these results show that 1) the lentiviral expressed miR126 (both sense and antisense strands) and miR140 antisense strand exhibit potent RNAi activity; 2) the lentiviral expressed miR451 antisense strand does not have any RNAi activity; 3) the observed RNAi activity of lentiviral expressed miR21 (both sense and antisense strands) and miR140 sense strand could be due to endogenous miRNAs. [score:13]
Expression of the sense but not the antisense strand of gga-miR451 inhibited Renilla luciferase activity, consistent with the report from miRBase [23]. [score:5]
Based on literature reports and the miRNA database (miRBase), we chose four endogenous chicken miRNAs gga-miR21, gga-miR126, gga-miR140 and gga-miR451 that are expressed in many different tissues of adult chicken and chicken embryo [22]. [score:3]
Because gga-miR21, gga-miR126, gga-miR140 and gga-miR451 are generally expressed, we assayed their activity in DF-1 cells by directly transfecting the reporter plasmids into DF-1 cells. [score:3]
[1 to 20 of 4 sentences]
30
[+] score: 23
To evaluate whether CD71 was a direct target of miR-320, we generated CMV -based expression constructs containing the miR-451 and miR-320 genomic sequences and then tested for their ability to specifically suppress expression from their respective “indicator” reporter constructs containing two copies of identical miR-451 or miR-320 target sequences in a specific manner (Fig 5F). [score:10]
The reporter activities when empty vector or miR-451 and miR-320 expression constructs were co -transfected into K562 cells with respective indicator plasmids containing duplicated copies of sequences identical to miR-451 and mIR-320. [score:3]
When this reporter construct was co -transfected into K562 cells with expression constructs encoding miR-320, miR-451 or empty vectors, we found that only miR-320, but not miR-451 or empty vectors, repressed its activity (Fig 5G, left). [score:3]
To assess the effect of miR-320 on CD71 3′UTR activity, expression constructs encoding miR-320 and miR-451 were inserted into a CMV -based pcDNA3 cloning vector (Invitrogen, CA). [score:3]
The following primers were used to amplified the expression constructs from the genomic DNA of K562 cells and cloned into the XhoI and EcoRI site of pcDNA3: miR-320 (forward: ccgaattccaggaaccagacagggacgc; reverse: ccctcgagccgactcttaagtccaggtc) and miR-451 (forward: ccgaattcacagtgcttttcaagccatgc; reverse: ccctcgagatcctcctgccttggcctctg). [score:2]
Several microRNAs (miR-320, let-7s, miR-181, miR-141) were over-represented in the HbAA erythrocytes, while other microRNAs (miR-29a, miR-144, miR-451, miR-140) were over-represented in the HbSS erythrocytes (Fig. 3C). [score:1]
In our analysis, HbSS erythrocytes have a very high level of miR-451, which was found be translocated into P. falciparum. [score:1]
[1 to 20 of 7 sentences]
31
[+] score: 23
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-198, hsa-mir-129-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-196a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-382, hsa-mir-383, hsa-mir-151a, hsa-mir-148b, hsa-mir-338, hsa-mir-133b, hsa-mir-325, hsa-mir-196b, hsa-mir-424, hsa-mir-20b, hsa-mir-429, hsa-mir-451a, hsa-mir-409, hsa-mir-412, hsa-mir-376b, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-181d, hsa-mir-499a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-301b, hsa-mir-216b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-499b, hsa-mir-378j
Uptake of hyperosmotic 2% saline water resulted in upregulation of expression of miR-7b, miR-9, miR-29b, miR-137, and miR-451 and downregulation of miR-409, miR-107, miR-103, miR-185, and miR-320 in hypothalamus in mice (Lee et al. 2006). [score:9]
OsmoticUptake of hyperosmotic 2% saline water resulted in upregulation of expression of miR-7b, miR-9, miR-29b, miR-137, and miR-451 and downregulation of miR-409, miR-107, miR-103, miR-185, and miR-320 in hypothalamus in mice (Lee et al. 2006). [score:9]
The expression of let-7a, miR-143, miR-145, and miR-202-3p was significantly higher in adult testis compared with adult ovary, and miR-451 was significantly downregulated in brain of juveniles compared with adult females (Bizuayehu et al. 2012b). [score:4]
Yu et al. (2010) have shown antioxidant activity of miR-451 in zebrafish embryos. [score:1]
[1 to 20 of 4 sentences]
32
[+] score: 22
Mature miRNA expression could be classified into two groups: i) cardia-tissues: miRNAs rarely expressed in other tissues but expressed in gastric cardia, including miR-148a, miR-192, miR-200a and miR-200b; ii) quasi-ubiquitous: miRNAs expressed in many tissues and conditions, including miR-29c, miR-21, miR-24, miR-29b, miR-29a, miR-451, miR-31, miR-145, miR-26a, miR-19b and let-7b. [score:9]
Six miRNAs showed a low variable pattern of expression (miR-29b, miR-29c, miR-19b, miR-31, miR-148a, miR-451) and could be considered part of the expression pattern of the healthy gastric tissue. [score:4]
Could observe miRNAs with high interindividual variation, for exempla miR-21, and another with low interindividual variation, e. g. expression pattern slightly variable (miR-29b, miR-29c, miR-19b, miR-31, miR-148a, miR-451). [score:3]
With the exception of miR-451, all shared at least two other gene targets. [score:3]
The high expression levels of miRNAs identified by ultra-deep sequencing (in descending order: miR-29c, miR-21, miR-148a, miR-29a, miR-24, miR-29b, miR-192, miR-451, miR-145, miR-31, miR-200a, miR-19b, miR-200b, let-7b and miR-26a) were validated with the TaqMan miRNA assays (Life Technologies). [score:2]
hsa-miR-451 GATAD2B; C11orf30; TSC1; VAPA; OSR1; FBXO33; CAB39; YWHAZ; PSMB8; SAMD4B; GK; AEBP2; CDKN2D; TTN. [score:1]
[1 to 20 of 6 sentences]
33
[+] score: 20
In summary, several previously known downregulated “tumor suppressor miRNAs” in malignant tumors, such as let-7d, miR-451, miR-23a, and miR-29 were found to be upregulated in schwannomas. [score:9]
Interestingly, the second most upregulated miRNA in schwanommas, miR-451 has also recently been shown to function as a potential tumor suppressor miRNA in human gastric and colon cancer cells, with its overexpression decreasing proliferation and increasing response to ionizing radiation in culture [28]. [score:8]
Based on the relative fold increase, as assessed by qRT-PCR assays, the most upregulated miRNAs in schwannomas were let-7d (about 22-fold), miR-451 (about 17-fold), and miR-23b (about 15-fold). [score:3]
[1 to 20 of 3 sentences]
34
[+] score: 20
At late differentiative stage, miR-486-5p shows the greatest expression, whereas miR-486-3p and miR-451 have more comparable expression levels, consistent to the highest expression of miR-451 in mature erythroid cells. [score:7]
In fact, bioinformatic analysis indicated BCL11A as a potential target of miR-144 which, together with miR-451, specifically regulate erythropoiesis [9], [56]. [score:4]
To better analyze the relative abundance of miR-486-3p and miR-486-5p in erythroid cells, their levels of expression were compared to that of miR-451, well known for its high erythropoietic-restricted expression in the hematopoietic system [9], [10]. [score:4]
As shown in figure 1C during the initial and middle stages of erythroid differentiation (i. e. day 5 and 7), miR-486-3p and miR-486-5p display a far higher expression level than miR-451. [score:3]
Erythropoiesis was reported to be promoted by miR-451 and miR-144 [9], [10] and negatively regulated by miR-150 [11], miR-221, miR-222 [12] and miR-223 [13]. [score:2]
[1 to 20 of 5 sentences]
35
[+] score: 19
In addition, miR-451, miR-27a, miR-21, miR-130a, miR-let-7, miR-137, miR-200c, miR-122, miR-138 and miR-10a/b were suggested to regulate ABCB1 gene expression indirectly by targeting other mRNAs that code the proteins associated with the activation of ABCB1 gene expression [72, 73, 74, 75, 76, 77, 78, 79]. [score:9]
In human medicine, miR-451, miR-331-5p, miR-27a, miR-298 and miR-145 were shown to regulate the expression of the ABCB1 gene by direct interaction with 3′-UTR [68, 69, 70, 71]. [score:5]
Zhu H. Wu H. Liu X. Evans B. R. Medina D. J. Liu C. G. Yang J. M. Role of microRNA miR-27a and miR-451 in the regulation of MDR1/P-glycoprotein expression in human cancer cells Biochem. [score:4]
Kovalchuk O. Filkowski J. Meservy J. Ilnytskyy Y. Tryndyak V. P. Chekhun V. F. Pogribny I. P. Involvement of microRNA-451 in resistance of the MCF-7 breast cancer cells to chemotherapeutic drug doxorubicin Mol. [score:1]
[1 to 20 of 4 sentences]
36
[+] score: 19
Other miRNAs from this paper: hsa-mir-451a, mmu-mir-451a, mmu-mir-451b
The negative regulation of 14-3-3ζ by miR-451 has been elegantly demonstrated in breast cancer cells where it was shown that tamoxifen treatment leads to loss of miR-451 expression and up-regulation of 14-3-3ζ, correlating with increased disease severity [42]. [score:9]
Thus the reciprocal expression of miR-451 and 14-3-3ζ may be important prognostic markers for disease severity and cancer progression in NSCLC. [score:5]
Intriguingly, miR-451 expression has also been shown to be low in NSCLC tissue compared with non-cancerous lung tissue, and up-regulation of miR-451 in A549 cells reduced cell growth and increased the cells susceptibility to cisplatin [43]. [score:5]
[1 to 20 of 3 sentences]
37
[+] score: 19
Furthermore, RA patients have reduced levels of miR-451, and there is evidence to support that restoration of its expression reduces the severity of the disease, making it an attractive candidate for therapeutics [37]. [score:5]
The expression of miR-451 negatively regulates neutrophil migration. [score:4]
A high expression of miR-451 in inflamed joints correlated with elevated DAS-28 (activity score), ESR, and serum IL-6 levels [52]. [score:3]
Additionally, miR-451 was also found to be expressed by T cells from RA patients and to be associated with elevated DAS-28, serum ESR, and IL-6 [41]. [score:3]
Ten miRNAs (let-7e, miR-128, miR-323-3p, miR-133b, miR-18b, miR-144, miR-451, miR-150, miR-486-3p, and miR-196b-5p) reflected a fourfold differential expression, and three miRNAs (miR-130b-5p, miR-452, and miR-579) were only identified in plasma from RA patients. [score:3]
These findings suggest an important role of miR-451 in modulating neutrophil recruitment and the perpetuation of an ongoing inflammatory response, therefore providing an important biomarker for both diagnosis and treatment in RA. [score:1]
[1 to 20 of 6 sentences]
38
[+] score: 17
Data also indicated that miR-451 regulates survival of NSCLC cells partially through the down-regulation of RAB14, which suggested that targeting miR-451/RAB14 interaction might serve as a novel therapeutic application to treat NSCLC patients [88]. [score:7]
miR-451 was the most down-regulated in NSCLC tissues [88]. [score:4]
Moreover, low expression level of miR-451 was found to be significantly associated with NSCLC tumor differentiation, pathological stage, lymph node metastasis, and shorter overall survival of patients. [score:3]
More recently, Brenner and collaborators analyzed and compared miRNAs profiles between primary tumor of patients with recurrent and non-recurrent GC and reported that three miRNAs (miR-451, miR-199a-3p and miR195) were differentially expressed in tumors from patients with good prognosis in comparison with patients with bad prognosis [107]. [score:2]
Of these, miR-451 had the strongest prognostic impact. [score:1]
[1 to 20 of 5 sentences]
39
[+] score: 17
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-101-1, hsa-mir-106a, hsa-mir-107, hsa-mir-16-2, hsa-mir-192, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-129-1, hsa-mir-148a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-210, hsa-mir-212, hsa-mir-214, hsa-mir-215, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-129-2, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-130b, hsa-mir-376c, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-20b, hsa-mir-429, hsa-mir-449a, hsa-mir-433, hsa-mir-451a, hsa-mir-193b, hsa-mir-520d, hsa-mir-503, hsa-mir-92b, hsa-mir-610, hsa-mir-630, hsa-mir-650, hsa-mir-449b, hsa-mir-421, hsa-mir-449c, hsa-mir-378d-2, hsa-mir-744, hsa-mir-1207, hsa-mir-1266, hsa-mir-378b, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-4512, hsa-mir-378i, hsa-mir-203b, hsa-mir-378j
Bandres et al. [94] reported that miR-451 functions as a tumor suppressor by repressing migration inhibitory factor (MIF), thereby activating Bcl-2, EGFR (epidermal growth factor receptor) and the phosphoinositide 3-kinase (PI3K)/Akt pathway in GC [95, 96]. [score:5]
In GC, high expression of miR-195 [58], miR-199a [39, 58, 62, 63, 64, 65], miR-1952 [58], miR-335 [82, 83], miR-375 [39, 74, 86, 87, 88], miR-451 [58, 94, 95, 96] and miR-4512 [39], and low expression of miR-142-5p [39] are more likely to indicate relapse or recurrence of GC patients. [score:5]
Bandres E. Bitarte N. Arias F. Agorreta J. Fortes P. Agirre X. Zarate R. Diaz-Gonzalez J. A. Ramirez N. Sola J. J. microRNA-451 regulates macrophage migration inhibitory factor production and proliferation of gastrointestinal cancer cells Clin. [score:4]
In addition, oncomiR-20b, miR-150 [23], miR-214 [24, 74], miR-375 [39, 74, 86, 87, 88], tumor suppressor Let-7g [24, 109, 110], miR-125-5p [126], miR-146a [24, 134], miR-218 [154], miR-433 [24, 86, 109, 110, 174], and miR-451 [24, 94, 230] are associated with a poor survival prediction in GC. [score:3]
[1 to 20 of 4 sentences]
40
[+] score: 17
Some miRNAs were upregulated 1, 3, and 14 days after infection (miR-15a); others were expressed late (miR-21, miR-206, and miR-451) or transiently upregulated (miR-223), whereas miR-146 was transiently downregulated (Table 1). [score:12]
Figure 3B shows the pathways regulated by two of these three miRNAs, i. e., miR-18a-5p and miR-223-3p (miR-451-3p is not included in the DIANA tool). [score:2]
As shown in Figure 3A, three miRNAs (miR-18a-5p, miR-223-3p, and miR-451-3p) were differentially regulated in all four species, suggesting a common IAV infection-related signature. [score:2]
The maturation of some miRNAs (for example, miR-451) is Dicer independent, but AGO dependent. [score:1]
[1 to 20 of 4 sentences]
41
[+] score: 16
Over -expression of miR-451 in gastric cancer and CRC cells resulted in reduction of cell proliferation, increased their susceptibility to radiotherapy, down-regulated expression of MIF at both mRNA and protein level. [score:8]
Furthermore, an inverse connection between miR-451 and MIF expression in biopsies of gastric tumors was observed, which suggested a role of miR-451 as a tumor suppressor. [score:5]
Recently, our group showed that MIF is a potential target of miR-451 [70]. [score:3]
[1 to 20 of 3 sentences]
42
[+] score: 16
Repression of miR-451 has been associated to ABCB1 up-regulation, impairing S. Typhimurium ability to invade host cells by reducing adhesion to epithelial cells [66, 67]; on the other hand, ABCB1 down-regulation (as in the present study) is associated with inflammatory reaction (TNF activation) in the gut in response to bacterial infections [66, 68]. [score:7]
We also found miR-451 overexpression in ileum, in agreement with a recent study of porcine blood miRNA profile after S. Typhimurium infection [40]. [score:3]
Assessment of some of the best candidates by qPCR confirmed the microarray results but the fold changes obtained by qPCR were very modest compared with the fold changes found in the microarray data, with the exception of miR-451 which showed highly significant differential expression. [score:2]
Although we validated the array results by qPCR (Table  2), we could observe that in general miRNA expression values were very moderate compared to mRNA results, and only miR-451 was found to be statistically significant and biologically meaningful (FC > 2, P < 0.001). [score:2]
miRNA qPCR microArray miR-374a-5p 1.18* 2.27* miR-30a-5p 1.02 2.4* miR-451 2.87*** 2.3* miR-454-3p −1.09 −2.27 Let-7b-5p 1.11 3.22* miR-27b-3p 1.07 2.62* All values are expressed in fold change (FC) compared to controls. [score:2]
[1 to 20 of 5 sentences]
43
[+] score: 16
The most abundantly upregulated miRNAs were miR-21-3p, miR-451-3p and miR-210-3p, of which miR-21 had an expression level in RCC exceeding 140,000 read counts/million. [score:6]
Of interest, the highly overexpressed MiR-451 and miRNA-27a have been reported to regulate multi-drug resistance (MDR) in carcinoma cell lines [21], and since RCC often express the MDR phenotype these two miRNAs might indeed be important in contributing to the RCC phenotype. [score:6]
Of the most abundantly expressed miRNAs, miR-21, miR-451, miR-125a and miR-204 together contributed to 27% and 18% of total miRNAs in ccRCC and normal kidney tissue. [score:3]
The nine most abundant miRNAs (miR-21, miR-145, miR-29a, miR-451, miR-29c, miR-23a, miR-126, miR140 and miR-125a) contributed up to 55%, 48% and 50% of the total miRNA pool in the 22 ccRCC tumors, 2 ccRCC cell lines and 11 normal kidney tissues, respectively. [score:1]
[1 to 20 of 4 sentences]
44
[+] score: 15
The generated mature miR-451 binds to the 3′UTR, and regulate expression of target genes. [score:6]
Instead of being processed by Dicer, pre-miR-451 is loaded onto AGO2 [89]; eukaryotic translation initiation factor (eIF1A) binds to the MID domain of AGO2 to form an eIF1A-AGO2 complex, promoting miR-451 maturation through the non-canonical pathway [88]. [score:3]
Non-canonical Pathway (Dicer independent); Following transportation from nucleus to cytoplasm, pre-miR-451 is directly assembled onto AGO2-eIF1A complex. [score:2]
[74, 75] AG02 AG02 regulates Dicer independent miRNA-451 through the non-canonical pathway. [score:2]
Consequently, the pre-miR-451 hairpin structure is cleaved by the Argonaute RNAase H-like motif to form the single strand mature miR-451. [score:1]
However, it has recently been reported that AGO2 affects miR-451 maturation mainly through the non-canonical pathway of miRNA biogenesis [88]. [score:1]
[1 to 20 of 6 sentences]
45
[+] score: 15
MiR-451 inhibits the tumorigenicity of cells associated with the downregulation of cyclin D1 and c-Myc, through targeting direct suppression of IKK-beta [25]. [score:10]
Importantly, miR-451 can inhibit EMT [92]. [score:3]
MiR-451 inhibited cell growth, induced G0/G1 arrest, and promoted apoptosis. [score:2]
[1 to 20 of 3 sentences]
46
[+] score: 15
Real time PCR confirmed overexpression of miR-126, miR-199b, and miR-451 and down-regulation of miR-29a expression in canine OS tumors as compared to normal canine osteoblasts (p ≤ 0.01). [score:7]
Real-time PCR was performed to independently validate changes in miRNA expression for 4 representative differentially expressed miRNAs (miR-29a, miR-126, miR-199b, miR-451) in a subset of primary canine osteoblasts cultures, osteoblast cell line (Ob, n = 5), and fresh primary canine OS tissues (OS, n = 16). [score:5]
Specifically, we verified the overexpression of miR-126, miR-199b, miR-451 in OS samples relative to normal osteoblasts. [score:3]
[1 to 20 of 3 sentences]
47
[+] score: 14
In aging primates, an upregulation of miR-451 in skeletal muscle associated with CR has been found [149]. [score:4]
Interestingly, some microRNAs that are differentially expressed by CR, have been described as regulators of nutrient sensing pathways (let-7, miR-34, miR-425, miR-16, miR-155, miR-144, miR-451). [score:4]
Chen M. B. Wei M. X. Han J. Y. Wu X. Y. Li C. Wang J. Shen W. Lu P. H. MicroRNA-451 regulates AMPK/mTORC1 signaling and fascin1 expression in HT-29 colorectal cancerCell Signal. [score:3]
In HT-29 cells and HEK-293 cells lines, miR-451 produces an inhibition of AMPK and an activation of mTORC1 [148]. [score:3]
[1 to 20 of 4 sentences]
48
[+] score: 14
To date, lots of miRNAs have been proposed to target the P-gp mRNA 3′UTR and inhibit its translation, such as miR-508-5p [18], miR-451 [19], miR-145 [20], miR-298 [21], miR-1253 [21], and miR-338 [21]. [score:7]
Recently, several miRNAs including miR-508-5p [18], miR-451 [19], miR-145 [20], miR-298 [21], miR-1253 [21], and miR-338 [21], have been proposed to target the P-gp mRNA 3′UTR and inhibit its translation. [score:7]
[1 to 20 of 2 sentences]
49
[+] score: 14
The expression patterns of three other miRNA (miR-451, miR-144, and miR-142) predicted to be expressed in erythroid cells were also examined (Figure 2C). [score:5]
C. Relative expression patterns of the GATA-1 regulated miRNA, miR-451 and miR-144, and hematopoietic tissue-specific microRNA, miR-142. [score:4]
Adult blood expression of miR-451 was increased, but that increase was not statistically significant. [score:3]
The miR-144 and miR-451 genes are known erythroid miRNA that are regulated by the GATA-1 transcription factor [18, 19]. [score:2]
[1 to 20 of 4 sentences]
50
[+] score: 14
In spheroid cell culture, downregulation of miR-451 induces the upregulation of macrophage migration inhibitory factor (MIF) and COX-2, resulting in the acquisition of self-renewal and tumorigenic properties (Bitarte et al., 2011). [score:9]
MIF and Cox-2 are involved in the activation of the Wnt pathway, which is functionally essential for the maintenance of colon (Vermeulen et al., 2010), suggesting that miR-451 could regulate the properties of colon by suppressing the Wnt pathway. [score:4]
MiR-451 is another regulator of CSC properties such as self-renewal, tumorigenicity, and drug resistance. [score:1]
[1 to 20 of 3 sentences]
51
[+] score: 14
In contrast to miR-451 locus whose expression was restricted to the fetal liver in embryonic day (E) 16.5 mouse embryos, the major site of haematopoiesis and erythropoiesis at this stage of development, miR-27a and miR-24 seem to serve as universal regulators in different cell types. [score:5]
Meanwhile, Dore et al. (6) found that dre-miR-451 could modulate zebrafish erythrocyte maturation via targeting gata-2. Their observations suggested the existing of a GATA-1/miR-451/GATA-2 axis in mouse and zebrafish erythropoiesis, although needs further validation. [score:3]
So far, a number of non-coding regulators such as miR-451 (5, 6), miR-23a (7), miR-221/222 (8), miR-376a (9) and miR-223 (10) were reported to play positive or negative roles in controlling erythropoiesis. [score:2]
Despite the fact that miR-451, miR-23a and mir-223 were shown to suffer from GATA-1 regulation in some species (6, 7, 11), there are virtually no data about GATA-1/2 switch dynamically operating on their genes during erythropoiesis. [score:2]
In mouse erythroid cells, GATA-1 was demonstrated to positively regulate a previously identified mmu-miR-451 (5). [score:2]
[1 to 20 of 5 sentences]
52
[+] score: 14
It is noteworthy that miR-451 and miR-205, two species whose levels were most downregulated in the plasma of lung SCC patients after surgical removal of the tumor, were selectively secreted by lung cancer cells into the medium. [score:4]
It is noteworthy that miR-451 and miR-205, which we found among the most downregulated miRNAs in the plasma of lung SCC patients after surgical removal of the tumor, are selectively secreted by lung cancer cells into the medium. [score:4]
However, miR-451 is known to be expressed at very high levels in red blood cells [26], i. e. significant amounts of miR-451 can be released in cases of slightly hemolyzed samples. [score:3]
The value of miR-451 as an oncomarker is questionable. [score:1]
We observed markedly decreased levels of miR-451 after tumor removal, even after exclusion of highly hemolyzed samples. [score:1]
The highest signal was detected for miR-451, -223, -15a, -486-5p, -16, and -21, which is in agreement with literature data [27]. [score:1]
[1 to 20 of 6 sentences]
53
[+] score: 13
In addition MiR-155 transduction greatly reduces both the myeloid and erythroid colony formation of normal human hematopoietic stem-progenitor cells [9], miR-221 and miR-222 inhibit normal erythropoiesis and erythroleukemia cell growth via kit protein down-regulation [10], miR-451 and GATA transcription factors were shown to comprise a regulatory circuit that modulates erythroid maturation [11- 13], miR-210 is involved in increased expression of the γ-globin gene in differentiating erythroid cells [14]. [score:9]
Several miRNAs were identified as deeply involved in the erythroid phenotype, including miR-15a, miR-16-1, miR-126, miR-144, miR-451 and miR-210 are believed to regulate several functions of erythroid cells such as maturation and proliferation of early erythroid cells, expression of fetal γ-globin genes and enucleation [5]. [score:4]
[1 to 20 of 2 sentences]
54
[+] score: 13
However, high expression of miR-451 has been detected in other tissues, suggesting that numerous cell types may require miR-451 for their maintenance and/or differentiation [57]. [score:3]
Interestingly, both MVs from MSCs and HLSCs showed the selective expression of miR-451 and miR-223, not detected in their cells of origin after the MV release. [score:3]
When the miRNA content of MSC-derived MVs was compared with that of the cells of origin, miR-223, miR-564 and miR-451 represented the three selectively expressed miRNAs in MVs. [score:2]
When the miRNA content of HLSC MVs was compared with that of the cells of origin, miR-223, miR-142-3p and miR-451 represented the most highly differentially expressed miRNAs. [score:2]
Previous research indicated that miR-451 is involved in the specific differentiation of erythrocytes [55], [56]. [score:1]
Moreover, miR-451 deficiency has been associated to a poor prognosis in gastric cancers [58]. [score:1]
The following miRNAs were tested: miR-221 (line1), miR-99a (line 2), miR-222 (line 3), miR-24 (line 4), miR-410 (line 5), miR-21 (line 6), miR-100 (line 7), miR-214 (line 8), miR-31 (line9), miR-223 (line 12), miR-122 (line 13) and miR-451 (line 14). [score:1]
[1 to 20 of 7 sentences]
55
[+] score: 13
MicroRNA-451 suppresses tumor cell growth by down -regulating IL6R gene expression. [score:5]
MicroRNA-451 functions as a tumor suppressor in human non-small cell lung cancer by targeting ras-related protein 14 (RAB14). [score:4]
2013; 19(6): 735– 6. 20 Tian Y, Nan Y, Han L, Zhang AL, Wang GX, Jia ZF, et al MicroRNA miR-451 downregulates the PI3K/AKT pathway through CAB39 in human glioma. [score:4]
[1 to 20 of 3 sentences]
56
[+] score: 13
After all the analysis, six out of 9 miRNAs remained significantly and more than 1.5 fold upregulated (miR340*, miR615-5p, miR545:9.1, miR451, miR454* and miR624*) and 1 out of 5 miRNA remained significantly and more than 1.5 fold downregulated (miR-1280) in both analyses (figure 2). [score:7]
Six platelet microRNAs were significantly upregulated (miR340*, miR451, miR454*, miR545:9.1. miR615-5p and miR624*) and one miRNA (miR1280) was significantly downregulated in patients with CAD as compared to healthy controls. [score:6]
[1 to 20 of 2 sentences]
57
[+] score: 13
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-101-1, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-30c-2, hsa-mir-199a-2, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-140, hsa-mir-141, hsa-mir-152, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-149, hsa-mir-150, hsa-mir-320a, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-379, hsa-mir-423, hsa-mir-451a, hsa-mir-486-1, hsa-mir-496, hsa-mir-520a, hsa-mir-525, hsa-mir-518b, hsa-mir-516b-2, hsa-mir-516b-1, hsa-mir-516a-1, hsa-mir-516a-2, hsa-mir-92b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, bta-mir-26a-2, bta-let-7f-2, bta-mir-101-2, bta-mir-103-1, bta-mir-16b, bta-mir-20a, bta-mir-21, bta-mir-27a, bta-mir-320a-2, bta-mir-125a, bta-mir-125b-1, bta-mir-199a-1, bta-mir-31, bta-mir-140, bta-mir-92a-2, bta-let-7d, bta-mir-132, bta-mir-191, bta-mir-192, bta-mir-22, bta-mir-23a, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-mir-150, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-99b, hsa-mir-1249, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, bta-mir-101-1, bta-mir-133a-2, bta-mir-133a-1, bta-mir-141, bta-mir-152, bta-mir-16a, bta-mir-24-1, bta-mir-199a-2, bta-mir-223, bta-mir-26a-1, bta-mir-379, bta-mir-451, bta-mir-486, bta-mir-496, bta-mir-92a-1, bta-mir-92b, bta-mir-1249, bta-mir-320b, bta-mir-320a-1, hsa-mir-320e, hsa-mir-23c, bta-mir-149, hsa-mir-486-2
c of RT-qPCR quantification of miR-451 in plasma (mean ± SEM) using different RNA volumes for reverse-transcription; highest reaction efficiency was obtained using 2 μL of RNA in a 10 μL cDNA synthesis reaction The presence of high levels of enzyme inhibitors in plasma samples (for example, immunoglobulin G) can significantly reduce the efficiency of RT-qPCR [29]. [score:3]
We detected a total of 208 miRNAs in bovine plasma (based on mean Cq < 35 across all sample pools; Fig.   4a), the most abundant of which (Fig.   4b) corresponded to miRNAs reportedly expressed at high levels in blood cells including erythrocytes (miR-451, miR-486, miR-16), leukocytes (miR-150, miR-27a, miR-23a) and thrombocytes (miR-223, miR-20a, miR-24), and which are putatively released into the plasma through apoptosis, lysis or active secretion [36– 38]. [score:3]
c of RT-qPCR quantification of miR-451 in plasma (mean ± SEM) using different RNA volumes for reverse-transcription; highest reaction efficiency was obtained using 2 μL of RNA in a 10 μL cDNA synthesis reactionThe presence of high levels of enzyme inhibitors in plasma samples (for example, immunoglobulin G) can significantly reduce the efficiency of RT-qPCR [29]. [score:3]
We confirmed the validity of this approach for bovine samples by showing good correlation between the ratio of miR-451 and miR-23a and optical densities at 414 nm (Additional file 1, A-B). [score:1]
b Expression level of the 20 most abundant miRNAs in bovine plasma (calculated as 2 [^(40-Ct)])Comparing the 20 most abundant miRNAs in each of the PCR array and sequencing datasets, only 6 miRNAs (miR-486, miR-22-3p, miR-191, miR-92a, miR-140 and miR-451) were common. [score:1]
As high levels of red blood cell-derived miRNAs such as miR-451 are associated with haemolysis [30, 31], the ΔCq between miR-451 and miR-23a has been proposed as a useful indicator of haemolysis [32]. [score:1]
b Expression level of the 20 most abundant miRNAs in bovine plasma (calculated as 2 [^(40-Ct)]) Comparing the 20 most abundant miRNAs in each of the PCR array and sequencing datasets, only 6 miRNAs (miR-486, miR-22-3p, miR-191, miR-92a, miR-140 and miR-451) were common. [score:1]
[1 to 20 of 7 sentences]
58
[+] score: 12
The expression profile of infected and uninfected cells was evaluated using a miRNA microarray, and 16 miRNAs were reported to be up-regulated (miR-4290, miR-4279, miR-625*, miR-let-7e, miR-1290, miR-33a, miR-3686, miR-378, miR-1246, miR-767-5p, miR-320c, miR-720, miR-491-3p, miR-3647, miR-451 and miR-4286) and 4 down-regulated (miR-106b, miR-20a, miR-30b and miR-3653) during dengue infection. [score:7]
This analysis identified IL-6 and CCL3 as potential targets of miR-let-7e and MIF, CCL5 and CXCL1 as potential targets of miR-451, miR-106b and miR-4279, respectively. [score:5]
[1 to 20 of 2 sentences]
59
[+] score: 12
In IAV-infected primary murine dendritic cells, strongly -induced miR-451 deregulates its target gene YWHAZ/14-3-3ζ. [score:4]
They appeared to inhibit the viral infection (e. g., miR-4276 [60] and miR-650 [61]) or to facilitate (e. g., miR-451 [62] and miR-548an [63]) IAV replication (Figure 1 and Table 1). [score:3]
Given these cytokines are important proteins in antiviral response, it is reasonable to hypothesize that the virus -induced expression of miR-451 in dendritic cells would be beneficial for the virus. [score:3]
Rosenberger C. M. Podyminogin R. L. Navarro G. Zhao G. W. Askovich P. S. Weiss M. J. Aderem A. miR-451 regulates dendritic cell cytokine responses to influenza infection J. Immunol. [score:2]
[1 to 20 of 4 sentences]
60
[+] score: 12
The identification of multiple elements within the miR-144/451 cluster is not surprising, as miR-144 and miR-451 are both highly expressed and upregulated by GATA1 during erythrocyte development [8]. [score:7]
Additionally, both miR-451 and miR-144 reside in a locus that is regulated by GATA-1, are highly induced during erythroid differentiation, and are critical to erythropoiesis [8]. [score:2]
GSEA was used to evaluate the potential enrichment and depletion of the predicated target mRNAs for the top six expressed erythrocyte microRNAs: miR-486-5p, miR-92-3p, miR-16-5p, let-7a/f, and miR-451 in erythrocyte mRNAs, compared to that of PBMC mRNAs. [score:2]
We have previously shown that higher levels of miR-144 and miR-451 reflect the hemolytic phenotype and malaria resistance of sickle erythrocytes, respectively [6, 7]. [score:1]
[1 to 20 of 4 sentences]
61
[+] score: 12
0007594.g004 Figure 4 In order to ascertain their relative expression level, a real-time PCR was carried out, and we found that miR-122 (p<0.0001), miR-451 (p = 0.0057) and miR-novel (p = 0.0006) have a higher level compared to others (Fig. 5), suggesting that these miRNAs play an important role in development and differentiation of the liver at 27 weeks. [score:3]
Specially, the variants with 3 and 4 bases longer for miR-451 were also analysed using RT-PCR and real-time PCR, and found to have stable expression (data not shown). [score:3]
In order to ascertain their relative expression level, a real-time PCR was carried out, and we found that miR-122 (p<0.0001), miR-451 (p = 0.0057) and miR-novel (p = 0.0006) have a higher level compared to others (Fig. 5), suggesting that these miRNAs play an important role in development and differentiation of the liver at 27 weeks. [score:3]
It can be speculated that these variants act on different target genes compared to the wildtype of miR-451. [score:2]
For example, five variants have been identified for miR-451 (Fig. 1). [score:1]
[1 to 20 of 5 sentences]
62
[+] score: 12
Downregulation of plasma miR-451 and miR-16 in Plasmodium vivax infection. [score:4]
Sickle cell erythrocyte infected person may have higher expression of the miRNA-451 and let-7i in blood (Eridani, 2013). [score:3]
Furthermore, lower expression of these two miRNAs (miRNA-451 and miRNA-16) significantly gives information about the parasite load in the blood (Chamnanchanunt et al., 2015). [score:3]
However, significantly lower plasma level of miRNA-16 and miRNA-451 has been reported in malaria patients (Chamnanchanunt et al., 2015). [score:1]
MiRNA-451 and miRNA-16 have been found to be down regulated in blood/serum of malaria patients as compared to healthy control. [score:1]
[1 to 20 of 5 sentences]
63
[+] score: 12
Other miRNAs from this paper: hsa-mir-200b, hsa-mir-200c, hsa-mir-200a, hsa-mir-451a
[114] Liu et al. demonstrated that miR-451 downregulated in NPC cell lines and tissue samples leading to enhanced cell migration and invasion in vitro and xenograft tumor growth in vivo by targeting MIF. [score:6]
[79] In renal cell carcinoma, miRNA-451 inhibited cell proliferation, migration and invasion through up-regulation of MIF. [score:6]
[1 to 20 of 2 sentences]
64
[+] score: 12
The miR-451 was highly expressed in the foetal and adult lung, foetal kidney, liver and spleen. [score:3]
Studies uncovered that the miR-451 functions as a tumor suppressor in human non-small cell lung cancer and glioma cells [29], [30]. [score:3]
The high level of miR-451 detected in the foetal and adult lung, foetal kidney, liver and spleen, indicates that miR-451 plays a role as a negative regulator in the growth and development of those organs. [score:3]
Also, the miR-451 displayed high expression level in both foetal and adult lungs. [score:3]
[1 to 20 of 4 sentences]
65
[+] score: 11
In addition to viral infections, hsa-miR-21 and hsa-miR-223 have been linked to inflammation and injury of the central nervous system [45– 48], hsa-miR-143-3p/hsa-miR-145-5p to muscle functioning [49, 50] and hsa-miR338/hsa-miR-451 downregulation to diabetes and inflammation [51, 52]. [score:4]
Interestingly enough, the studies recently performed by O´Connor et al., in a rat mo del of depression induced by early-life stress, show a marked inhibition of the miRNA-451 that could be attenuated by antidepressant treatment [55] suggesting that some of our FM patient symptoms may improve with this type of medication possibly through mechanisms involving miRNA-451. [score:3]
GF: General Fatigue; PF: Physical and MF: Mental Fatigue, RA: reduced activity and RM: reduced motivation, are subscales of the MFI (Multidimensional Fatigue Inventory) (scale 0–20) [28] However, it is interesting to note that patient FM9 who had the lowest mental fatigue score (8) compared to an average of 14.3±2.8 in the FM group (n = 11), presented the highest levels for 4 of the 5 markedly inhibited miRNAs: hsa-miR-143, hsa-miR145, hsa-miR223 and hsa-miR451, with values for the two first miRNAs above lowest levels in control subjects and with a less than two-fold difference for the other two miRNAs (hsa-miR223 and hsa-miR451) with respect to its corresponding reference value in the control group (lowest control level, S4 Table, (a) values), suggesting a possible correlation between some of these miRNAs and mental fatigue severity. [score:2]
GF: General Fatigue; PF: Physical and MF: Mental Fatigue, RA: reduced activity and RM: reduced motivation, are subscales of the MFI (Multidimensional Fatigue Inventory) (scale 0–20) [28]However, it is interesting to note that patient FM9 who had the lowest mental fatigue score (8) compared to an average of 14.3±2.8 in the FM group (n = 11), presented the highest levels for 4 of the 5 markedly inhibited miRNAs: hsa-miR-143, hsa-miR145, hsa-miR223 and hsa-miR451, with values for the two first miRNAs above lowest levels in control subjects and with a less than two-fold difference for the other two miRNAs (hsa-miR223 and hsa-miR451) with respect to its corresponding reference value in the control group (lowest control level, S4 Table, (a) values), suggesting a possible correlation between some of these miRNAs and mental fatigue severity. [score:2]
[1 to 20 of 4 sentences]
66
[+] score: 11
5) 7 hsa-mir-19a dbDEMC 32 hsa-mir-30d dbDEMC 8 hsa-mir-92a HMDD, miR2Disease 33 hsa-mir-451 literature 9 hsa-mir-210 miR2Disease 34 hsa-mir-152 dbDEMC 10 hsa-mir-19b dbDEMC, miR2Disease 35 hsa-mir-215 dbDEMC 11 hsa-mir-224 dbDEMC, miR2Disease 36 hsa-mir-130a dbDEMC, HMDD 12 hsa-let-7f dbDEMC, miR2Disease 37 hsa-mir-499 higher RWRMDA (No. [score:11]
[1 to 20 of 1 sentences]
67
[+] score: 11
Moderate correlation was reported between expression level of miRNA and type of isomiRs [15], but unexpectedly, we herein found some exceptions: miR-519a was found fewer type of isomiRs although it had higher expression levels than miR-451 (Figure 6). [score:5]
Indeed, the phenomenon of various expression differences could be detected according to more miRNAs: the most abundant isomiR of miR-130a was over 29.60-fold than the secondary abundant isomiR (Figure 6A), while similar expression levels (over 1.17-fold) could be found between the most and secondary abundant isomiRs of miR-451 (Figure 6D). [score:5]
For example, in mild sample, miR-451 was found 10 variants (sequence counts of them were over 99), while miR-130a was only found 2 variants (Figure 5 and Figure 6). [score:1]
[1 to 20 of 3 sentences]
68
[+] score: 11
These data suggests miR-451 may play a role in suppressing carcinogenesis and could be a target for cancer therapy. [score:5]
By contrast, overexpression of miR-451 leads to reduction of cell proliferation and increase of sensitivity to radiotherapy. [score:3]
The expression of miR-451 was reduced in GC and related with worse prognosis [94]. [score:3]
[1 to 20 of 3 sentences]
69
[+] score: 11
Thus, miR-182 and miR-183 are overexpressed and miR-1, miR-133b, miR-143, miR-145, miR-214, miR-368, miR-451, and miR-7029 are underexpressed in both cell lines containing integrated HPV16 or HPV18 DNA [30]. [score:5]
HPV18 positive HeLa cell line has overexpression of miR-182 and miR-183, while miR-1, miR-133b, miR-143, miR-145, miR-214, miR-368, miR-451, and miR-7029 are underexpressed in this cell line as compared with normal cervical tissue. [score:4]
In contrast, miR-1, miR-126, miR-133b, miR-143, miR-145, miR-195, miR-214, miR-368, miR-451, and miR-7029 are underexpressed in these cell lines as compared with normal cervical tissue. [score:2]
[1 to 20 of 3 sentences]
70
[+] score: 10
Increased expression of miR-451 by administration of miR-451 mimics oligonucleotides reversed the biology of each of the three cell lines, inhibiting cell growth, inducing G0/G1 phase arrest and increasing cell apoptosis. [score:5]
Consistent with our analysis, previous studies have also revealed the down-regulation of miR-451 in A172, LN229 and U251 human GBM cells. [score:4]
Further, treatment with miR-451 mimics oligonucleotides diminished the invasive capacity of these cells, as the number of cells invading through matrigel was significantly decreased [35]. [score:1]
[1 to 20 of 3 sentences]
71
[+] score: 10
Unique miRNAs were associated with the progression and prognosis of GC as meaningful prognostic markers [56, 57], which is summarized in Table 1. Elevated miR-21 expression was significantly correlated with size and depth [58], and low expression levels of miR-451 [38] and miR-125a-5p was associated with enhanced malignant potential such as tumor size, tumor invasion, liver metastasis, and poor prognosis [59]. [score:5]
The results suggested that miR-451 [38] and miR-141 could be involved in the development of GC through their inhibitory effect on cell proliferation [39]. [score:4]
Meanwhile, a study comparing pre- and post-operative plasma miRNA levels led to the identification of two miRNAs, miR-451 and miR-486, as potential biomarkers for GC, as they were highly abundant in plasma and showed a marked decrease in post-operative samples [75]. [score:1]
[1 to 20 of 3 sentences]
72
[+] score: 10
Numerous studies have shown that miR-99b, miR-100, miR-199a-3p, miR-451, miR-144 and miR-101 can directly or indirectly mediate mTOR expression [18- 23], and reduction of these miRNAs was connected with the elevated levels of mTOR in prostate cancer and endometrial carcinoma [18, 24]. [score:5]
To identify whether miRNAs were involved in radiation induced mTOR aberrant expression and activation, several miRNAs which targeted mTOR kinase including miR-101, miR-144, miR-100, miR-451, miR-199a and miR-99b were tested before and after radiation treatment. [score:5]
[1 to 20 of 2 sentences]
73
[+] score: 10
The qRT-PCR confirmed changes of the selected miRNAs (Figure  4B), decreased expression of miR-96, miR-141, miR-182, miR-183, miR-200a, miR-200b, miR-429 and miR-451 in F2-SSS compared to F0-S animals, whereas miR-23b and miR-200c showed increased expression levels. [score:4]
Moreover, miR-451 is expressed in the uterus [58, 59] and regulated by estrogen and progesterone [58]. [score:4]
In order to validate miRNAs, we performed quantitative real time PCR (qRT-PCR) analysis of these differentially regulated miRNAs (n = 3 per group for F0, F1 and F2 generations, three replicates per sample): miR-23b, miR-96, miR-141, miR-181a, miR-182, miR-183, miR-200a, miR-200b, miR-200c, miR429 and miR-451. [score:2]
[1 to 20 of 3 sentences]
74
[+] score: 10
hsa-mir-155 HMDD hsa-mir-101 mir2Disease hsa-mir-19b HMDD hsa-mir-146a mir2Disease hsa-mir-21 HMDD hsa-mir-373 HMDD hsa-mir-92a HMDD hsa-mir-214 HMDD hsa-mir-9 HMDD hsa-mir-143 HMDD hsa-mir-451 HMDD hsa-mir-25 HMDD hsa-mir-125b HMDD hsa-mir-181b HMDD hsa-mir-24 HMDD hsa-mir-20b uncomfirmed hsa-mir-145 HMDD hsa-mir-32 HMDD hsa-mir-223 HMDD hsa-mir-16 HMDD 10.1371/journal. [score:5]
hsa-mir-155 HMDD hsa-mir-101 mir2Disease hsa-mir-19b HMDD hsa-mir-146a mir2Disease hsa-mir-21 HMDD hsa-mir-373 HMDD hsa-mir-92a HMDD hsa-mir-214 HMDD hsa-mir-9 HMDD hsa-mir-143 HMDD hsa-mir-451 HMDD hsa-mir-25 HMDD hsa-mir-125b HMDD hsa-mir-181b HMDD hsa-mir-24 HMDD hsa-mir-20b uncomfirmed hsa-mir-145 HMDD hsa-mir-32 HMDD hsa-mir-223 HMDD hsa-mir-16 HMDD 10.1371/journal. [score:5]
[1 to 20 of 2 sentences]
75
[+] score: 10
Moreover, we tested the target specificity of the 6C-miR-18–11bp probe against a non-specific miRNA background, by incubating the 6C-miR-18–11bp probe with several non-target miRNAs, miR-200c, miR-125c, miR-221, miR-27b, miR-451 and miR-21 (Figure 6C). [score:5]
The 6C-miR-21–10bp probe was incubated with several non-target miRNAs such as miR-200c, miR-125c, miR-221, miR-27b, miR-451 and miR-18a (Figure 5B). [score:3]
1.5 μM 6C-miR-21–10bp probe was mixed with 1.5 μM of miR-21 (black bar), miR-200c (red bar), miR-125c (green bar), miR-221 (blue bar), miR-27b (sky blue bar), miR-451 (pink bar) and miR-18a (yellow bar). [score:1]
1.5 μM of 6C-miR-18a-11bp probe was mixed with 1.5 μM of miR-18a (black bar), miR-21 (red bar), miR-200c (green bar), miR-125c (blue bar), miR-221 (sky blue bar), miR-451 (pink bar) and miR-27b (yellow bar). [score:1]
[1 to 20 of 4 sentences]
76
[+] score: 10
Upregulation of miR-451 expression inactivates the AKT signaling pathway and enhanced cisplatin induced apoptosis in A549 cells [17]. [score:6]
For instance, miR-451 is downregulated in NSCLC tissues and is capable of conferring resistance to cisplatin in non-small cell lung cancer cell line (A549) [40]. [score:4]
[1 to 20 of 2 sentences]
77
[+] score: 10
The four highest-expressed miRNAs (miR-486-5p, miR-451, miR-16 and miR-92a) are known to be highly expressed in erythrocytes 32, 33. [score:5]
We observed in the horse blood that the two most abundant miRNAs (miR-486-5p, miR-451) were expressed at such high levels relative to the remaining miRNAs that they affected quantification of the raw data. [score:3]
Approximately 13% of the total reads corresponded to the second most abundant miRNA, miR-451, while miR-16 and miR-92a each took up about 1.5% of reads. [score:1]
Global normalization (counts per million, CPM) made very little discernable improvement over L filter alone, whilst removal of both low count miRNAs and the two over-abundant outliers (miR-486 and miR-451) followed by CPM normalization led to a greatly improved profile (LH filter + CPM). [score:1]
[1 to 20 of 4 sentences]
78
[+] score: 10
Specifically, there was a 2.05 fold up-regulation (7.25 fold in deep sequencing analysis) in miR-451, and 4.71 fold down regulation (2.86 fold in deep sequencing analysis) in miR-206 with AIV infection in lungs (P < 0.05). [score:5]
The expression levels of miR-206 and miR-451 in each sample were measured in terms of threshold cycle value and normalized to U6 expression using 2 [-∆∆CT][48]. [score:3]
There was general consistency between the TaqMan assays and deep sequence analysis of miR-451 and miR-206 in terms of direction of regulation and statistical significance (Figure 3). [score:2]
[1 to 20 of 3 sentences]
79
[+] score: 9
Other miRNAs from this paper: hsa-mir-21, hsa-mir-221, hsa-mir-222, hsa-mir-328, hsa-mir-451a
This was evidenced by (a) downregulation of miR-451 leads to the increased metabolism of DOX [22]; (b) downregulation of miR-328 results in increased mitoxantrone sensitivity [23]; and (c) Overexpression of miR-221 and miR-222 in MCF-7 cells confers resistance to tamoxifen [24]. [score:9]
[1 to 20 of 1 sentences]
80
[+] score: 9
The regulation of 14-3-3 proteins by microRNAs has been documented where 14-3-3zeta is a direct target of miR-451 [28]. [score:5]
Tamoxifen downregulation of miR-451 increases 14-3-3ζ and promotes breast cancer cell survival and endocrine resistance. [score:4]
[1 to 20 of 2 sentences]
81
[+] score: 9
Other miRNAs from this paper: hsa-mir-16-1, hsa-mir-16-2, hsa-mir-451a
Expression of miR-16 and miR-451 in the exosomes isolated from the different techniques and volumes of serum. [score:3]
We selected two miRNAs, hsa-miR-16 and hsa-miR-451, which have been previously reported as being abundantly expressed in isolated serum exosomes [39, 54, 55]. [score:3]
For the miR-451 linear correlations, the R [2] values for miRCURY, ExoQuick, TEIR, and UC were 0.957, 0.8279, 0.9547, and 0.8692, respectively. [score:1]
The expression levels of miR-16 and miR-451, measured using ddPCR, indicate that each isolation technique may produce a slightly different profile of exosome RNA. [score:1]
With miR-451, only miRCURY and ExoQuick were statistically different (p = 0.0002). [score:1]
[1 to 20 of 5 sentences]
82
[+] score: 9
Other miRNAs from this paper: mmu-let-7i, hsa-let-7i, hsa-mir-451a, mmu-mir-451a, mmu-mir-451b
Downstream, miR-451 appears to fuse with transcripts of the regulatory subunit of the parasite's cAMP -dependent protein kinase (PKA-R) to reduce its translation, thereby upregulating activity of its substrate PKA and ultimately disrupting multiple parasite developmental pathways. [score:8]
Specifically, the host miRNAs miR-451 and let-7i were significantly more abundant in HbAS and HbSS RBCs, and were associated with attenuated parasite growth in these cells. [score:1]
[1 to 20 of 2 sentences]
83
[+] score: 9
Other miRNAs from this paper: hsa-mir-23a, hsa-mir-223, hsa-mir-451a, hsa-mir-486-1, hsa-mir-486-2
Four-hundred thirty-nine samples had values between 5.0 and 6.99, 9 samples did not express miR451, 24 samples did not expressed miR-23a and 88 samples did not expressed either miRNA. [score:7]
For miR-23a-miR-451, increased delta quantification cyle (Cq) values <5 would suggest little or no haemolysis and >7 would be indicative of significant haemolysis. [score:1]
For our samples, the delta Cq value of miR-23a and miR-451 were <5.0 in 2,179 out of 2,763 samples. [score:1]
[1 to 20 of 3 sentences]
84
[+] score: 9
Of these, 14 (miR-23b, miR-28, miR-98, miR-103, miR-107, miR-193a,0, miR-324-5p, miR-324-3p, miR-331, miR-374, miR-432, miR-502, and miR-660) were upregulated and 6 (miR-31, miR-451, miR-452, miR-565, miR-594 and miR-659) were downregulated. [score:7]
[27]↓quail myoblasts diff, ↓ C2C12 diff [29] ↓ C2C12 diff [28] ↓ muscle development [32]40miR-320↓(this study)↑ pMyo diff [33]  41 miR-324-3p (n)↑↑(this study)   42 miR-324-5p (n)↑(this study)   43 miR-331 (n)↑(this study)-  44miR-339↓(this study)↑ C2C12 diff [33] ↑ pMyo diff [33]  45miR-361↑(this study)↑ pMyo diff [33]  46 miR-362↑↑(this study)↑ C2C12 diff [28]  47 miR-374 (n)↑(this study)   48 miR-432 (n)↑(this study)   49 miR-451 (n)↓↓↓(this study)   50 miR-452 (n)↓↓(this study)   51 miR-500↑↑(this study)↑ C2C12 diff [28, 33] ↑ pMyo diff [33]  52 miR-501↑↑↑(this study)↑ C2C12 diff [28, 33]  53 miR-502 (n)↑↑(this study)-  54 miR-503↑(this study)↑ C2C12 diff [19, 28, 33] ↑ pMyo diff [33]  55 miR-532↑↑(this study)↑ C2C12 diff [28, 33] ↑ pMyo diff [33]  56↓↓ pMyo diff. [score:2]
[1 to 20 of 2 sentences]
85
[+] score: 8
Gits C. M. van Kuijk P. F. Jonkers M. B. Boersma A. W. Smid M. van Ijcken W. F. Coindre J. M. Chibon F. Verhoef C. Mathijssen R. H. MicroRNA expression profiles distinguish liposarcoma subtypes and implicate miR-145 and miR-451 as tumor suppressorsInt. [score:5]
The experimental overexpression of miR-145 and miR-451 results in diminished cellular proliferation, impairs cell cycle progression and induces apoptotic cell death [38]. [score:3]
[1 to 20 of 2 sentences]
86
[+] score: 8
Levels of certain RNA sequences were substantially different between exosomes and parental serum sample as illustrated in Figure 8. A subset of 3 miRNA targets showed different representation profiles between the two sample types: miR-1281 and miR-4257 were higher in exosomes, while miR-451 was significantly higher in parental sample. [score:3]
Reverse Transcription (RT) Master Mix was prepared for each sample using the TaqMan MicroRNA Reverse Transcription Kit reagents and protocol (Applied Biosystems) with gene specific RT primers for five miRNA targets (miR16, miR24, miR26a, miR451, and let7e). [score:2]
miR-451, for instance, was reported as associated with resistance to chemotherapy in ovarian cancer [47] as well as playing a part in controlling glioma cell proliferation and migration [48]. [score:1]
Before proceeding with the sequencing analysis of the RNA, the levels of five microRNAs miR16, miR24, miR26a, miR451, and let7e, earlier reported to be present in exosomes [11, 21], were quantified by qRT-PCR. [score:1]
For exosomes, the sequences that stand out include hsa-mir-1246, hsa-mir-451, chr6. [score:1]
[1 to 20 of 5 sentences]
87
[+] score: 8
Mechanisms of aging under the regulation of miRNAs may contribute to AD pathology, such as those identified in various aging mo del systems, including the up-regulation of let-7f, miR-30d, -34a, -432, -517 and down-regulation of let-7i and miR-451 (Table 2). [score:8]
[1 to 20 of 1 sentences]
88
[+] score: 7
Nevertheless, the individual study reported by Xie et al. [98], where the data for meta-analysis is derived from, showed that miR-10b*, miR-144, and miR-451 in WS, and miR-10b*, miR-144, miR-21, and miR-451 in CFS were significantly up-regulated in patients with ESCC, with sensitivities of 89.7%, 92.3%, 84.6%, 79.5%, 43.6%, 89.7%, and 51.3%, and specificities of 57.9%, 47.4%, 57.9%, 57.9%, 89.5%, 47.4%, and 84.2%, respectively, therefore demonstrating that saliva miRNAs possess discriminatory power for detection of ESCC. [score:4]
They have identified a panel of nine miRNAs—miR-451, miR-16, miR-135b, miR-10b, miR-124a, miR-372, and miR-412, miR-658, miR-205 (being the last two specific of saliva)—that are differentially expressed to such a degree as to permit the identification of the body fluid origin of forensic biological stains using as little as 50 pg of total RNA. [score:3]
[1 to 20 of 2 sentences]
89
[+] score: 7
Other miRNAs from this paper: hsa-mir-200b, hsa-mir-373, hsa-mir-451a
Another miR, miR-451, has tumour suppressor functions in human non-small cell lung cancer, and could act by suppressing the expression of Rab14 [71]. [score:7]
[1 to 20 of 1 sentences]
90
[+] score: 7
Other microRNAs, such as miR223 expressed in IL-4-activated macrophages, miR451 in dendritic cells and miR335 in T cells, have been demonstrated in extracellular vesicles from normal cell types (Mittelbrunn et al., 2011; Yang et al., 2011). [score:3]
MiR451 has been identified as a tumor suppressor, defining proliferation and cell polarity. [score:2]
Breast and ovarian tumor cells have been demonstrated to release >99% of miR451 and miR1246 produced by the cells (Pigati et al., 2010; Gercel-Taylor et al., 2013). [score:1]
miR451 has also been shown to induce chemosensitivity. [score:1]
[1 to 20 of 4 sentences]
91
[+] score: 7
Overexpression of miR-181a, miR-181b, miR-221, miR-222 and miR-451 (10 µM) resulted in no observable phenotype in zebrafish embryos at 2 dpf. [score:3]
Recent study on gain-of-function of miR-451 also did not generate a visible phenotype, corroborating with our observations [22]. [score:1]
However the role of miR-451 in erythroid maturation was demonstrated in zebrafish meunier mutant background [22]. [score:1]
The miRNAs that did not produce any visible vascular phenotypes in our screen include miR-181a, miR-181b, miR-221, miR-222 and miR-451. [score:1]
Zebrafish embryos injected with miR-221, miR-222 and miR-451 display no observable phenotype (figure not shown). [score:1]
[1 to 20 of 5 sentences]
92
[+] score: 7
Sun Y. Peng R. Peng H. Liu H. Wen L. Wu T. Yi H. Li A. Zhang Z. miR-451 suppresses the NF-kappaB -mediated proinflammatory molecules expression through inhibiting LMP7 in diabetic nephropathyMol. [score:7]
[1 to 20 of 1 sentences]
93
[+] score: 7
This was evidenced by the overexpression of miR-221/222, conferring resistance to tamoxifeninMCF-7 cells, and the down-regulation of miR-451 and miR-328, which could result in increased DOX and mitoxantrone sensitivity, respectively [24, 25, 26]. [score:6]
Kovalchuk O. Filkowski J. Meservy J. Ilnytskyy Y. Tryndyak V. P. Chekhun V. F. Pogribny I. P. Involvement of microRNA-451 in resistance of the MCF-7 breast cancer cells to chemotherapeutic drug doxorubicin Mol. [score:1]
[1 to 20 of 2 sentences]
94
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-99a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-99a, mmu-mir-140, mmu-mir-10b, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-191, hsa-mir-192, hsa-mir-148a, hsa-mir-30d, mmu-mir-122, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-122, hsa-mir-140, hsa-mir-191, hsa-mir-320a, mmu-mir-30d, mmu-mir-148a, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-21a, mmu-mir-22, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-92a-2, mmu-mir-25, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-92a-1, hsa-mir-26a-2, hsa-mir-423, hsa-mir-451a, mmu-mir-451a, hsa-mir-486-1, mmu-mir-486a, mmu-mir-423, bta-mir-26a-2, bta-let-7f-2, bta-mir-148a, bta-mir-21, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-140, bta-mir-92a-2, bta-let-7d, bta-mir-191, bta-mir-192, bta-mir-22, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, hsa-mir-1246, bta-mir-24-1, bta-mir-26a-1, bta-mir-451, bta-mir-486, bta-mir-92a-1, bta-mir-181a-1, bta-mir-320a-1, mmu-mir-486b, bta-mir-1246, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, hsa-mir-486-2
There were eight microRNAs (bta-miR-27b, bta-miR-191, bta-miR-30d, bta-miR-451, bta-miR-25, bta-miR-140, bta-miR-24-3p, and bta-miR-122), that were upregulated in older animals in the present study, and upregulated in fetal muscle tissue of the study. [score:7]
[1 to 20 of 1 sentences]
95
[+] score: 7
Bandres et al. revealed that miR-451 was down-regulated in primary gastric and colorectal tumors, and the down-regulation of miR-451 was associated with low DFS and low overall survival [25]. [score:7]
[1 to 20 of 1 sentences]
96
[+] score: 7
Tian Y. Nan Y. Han L. Zhang A. Wang G. Jia Z. Hao J. Pu P. Zhong Y. Kang C. MicroRNA miR-451 downregulates the PI3K/AKT pathway through CAB39 in human glioma Int. [score:4]
Nan Y. Han L. Zhang A. Wang G. Jia Z. Yang Y. Yue X. Pu P. Zhong Y. Kang C. MiRNA-451 plays a role as tumor suppressor in human glioma cells Brain Res. [score:2]
Godlewski J. Nowicki M. O. Bronisz A. Nuovo G. Palatini J. de Lay M. van Brocklyn J. Ostrowski M. C. Chiocca E. A. Lawler S. E. MicroRNA-451 regulates LKB1/AMPK signaling and allows adaptation to metabolic stress in glioma cells Mol. [score:1]
[1 to 20 of 3 sentences]
97
[+] score: 7
The comparison between control- and MPA -treated cells revealed that 16 miRNAs were significantly modulated by more than two-fold (P < 0.05, Figure 1A), nine miRNAs were upregulated (miR-191*, miR-17*, miR- 470*, miR-451, miR-702, miR-434-3p, miR-493, miR-23a* and miR-485*) and seven were downregulated (miR-378*, miR-376a, miR-224, miR-190b, miR-16, miR-410 and miR-197) (Figure 1B). [score:7]
[1 to 20 of 1 sentences]
98
[+] score: 7
For example, miR-451, one of the 11 miRNAs we found modulated in the HD monkeys, is also upregulated in HD patients [24]. [score:4]
However, miR-451 does not appear to be disrupted in HD mice mo dels, suggesting the involvement of this miRNA in disease progression may be restricted to primates. [score:3]
[1 to 20 of 2 sentences]
99
[+] score: 7
In an ischemia -induced mo del of retinal neovascularization, seven miRNAs (miR-106a, miR-146, miR-181, miR-199a, miR-214, miR-424, and miR-451) were upregulated, and three miRNAs (miR-31, miR-150, and miR-184) were downregulated. [score:7]
[1 to 20 of 1 sentences]
100
[+] score: 6
For example, evolutionarily conserved sequences such as miR-451 and miR-150 are highly expressed in bone marrow [15], regulating hematopoiesis, and miR-126 and let-7 family members show high expression in lung [16, 17]. [score:6]
[1 to 20 of 1 sentences]