sort by

18 publications mentioning mmu-mir-28c

Open access articles that are associated with the species Mus musculus and mention the gene name mir-28c. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 158
Figure 2B displays discrepancies between the miRNA array and RT-qPCR data, showing that only 3 down-regulated miRNAs (miR-150, miR-28 and miR-151-5p) and 8 upregulated miRNAs (miR-let-7e, miR-103, miR-107, miR-27a, miR-23a, miR-21, miR-155 and miR-146a) showed similar trends in altered miRNA levels. [score:7]
Defining the potential targets of exhaustion -associated inhibitory receptors PD1 by miR-28. [score:5]
PD1, TIM3, BTLA gene expression after transfection with miR-28 mimic or miR-28 inhibitor. [score:5]
On the contrary, the expression of PD1, TIM3 and BTLA were increased after transfection with miR-28 inhibitors (Figure 5A– 5C). [score:5]
The levels of PD1, TIM3 and BTLA after transfected with miR-28 mimic or inhibitor were then expressed relative to that control miRNA group. [score:5]
Our study expands the role of miR-28 to that of an indirect tumor suppressor by decreasing the phenotype of exhaustion and regulating the cytokine IL-2 and TNF-α secretion. [score:5]
On the contrary, miR-28 inhibitors increased PD1, meanwhile, increased TIM3 and 2B4 expression. [score:5]
To investigate the function of miR-28 to regulate the expression of IRs, T cells isolated from B16F10-bearing mice was transfected with miR-28 mimic or inhibitor. [score:4]
Taken together, these data indicate that miR-28 may regulate PD1 and TIM3 expression in vitro partially. [score:4]
miR-28 regulating the gene expression of PD1, TIM3 and BTLA. [score:4]
Two million lymphocytes, collected from lymph nodes of B16F10-bearing mice, were plated per well in a 24 well plate and transfected with 1 μg of miR-28 mimic or inhibitor, then cells were cultured with anti-CD3e (10 μg/ml) coating plates for 72 hrs. [score:3]
Figure 6Two million lymphocytes, collected from lymph nodes of B16F10-bearing mice, were plated per well in a 24 well plate and transfected with 1 μg of miR-28 mimic or miR-28 inhibitor, then cells were cultured in anti-CD3e (10 μg/ml) coating plates for 72 hrs. [score:3]
To test whether miR-28 reverse the cytokine secretion of exhausted T cells, we collected T cells from the lymph nodes of B16F10-bearing mice, cultured in anti-CD3e coating plates, and transfected them with either miR-28 mimic or inhibitor. [score:3]
Figure 8Two million lymphocytes, collected from lymph nodes of B16F10-bearing mice, were plated per well in a 24 well plate and transfected with 1 μg of miR-28 mimic or inhibitor, then cells were cultured with anti-CD3e (10 μg/ml) coating plates for 72 hrs. [score:3]
miR-28 mimic silenced the 3’ UTR of PD1 and decreased PD1 expression. [score:3]
In a non-immune cell related cancer, clear cell renal cell carcinoma, transfection with miR-28 mimic was shown to weaken mitotic checkpoint activation and to induce chromosomal instability by targeting MAD2L1 [38]. [score:3]
Two million lymphocytes, collected from lymph nodes of B16F10-bearing mice, were transfected with 1 μg of miR-28 mimic or miR-28inhibitor, then cells were made exhaustive by the culture with anti-CD3e (10 μg/ml) coating plates for 72 hrs. [score:3]
On the contrary, the miR-28 inhibitor decreased the TNF-α secretion (Figure 8B). [score:3]
The PD1 gene expression was decreased after transfection with miR-28 mimic (Figure 5A). [score:3]
T cell transfection with miR-28 mimics and inhibitors. [score:3]
Figure 5Two million lymphocytes, collected from lymph nodes of B16F10-bearing mice, were transfected with 1 μg of miR-28 mimic or miR-28inhibitor, then cells were made exhaustive by the culture with anti-CD3e (10 μg/ml) coating plates for 72 hrs. [score:3]
We further describe miRNAs that can regulate PD1, and that in vitro transfection of miR-28 mimics acts therapeutically to reduce exhausted T cells and regulate the cytokine secretion in the tumor microenvironment. [score:3]
Two million lymphocytes, collected from lymph nodes of B16F10-bearing mice, were plated per well in a 24 well plate and transfected with 1 μg of miR-28 mimic or miR-28 inhibitor, then cells were cultured with anti-CD3e (10 μg/ml) coating plates for 72 hrs. [score:3]
Two million lymphocytes, collected from lymph nodes of B16F10-bearing mice, were plated per well in a 24 well plate and transfected with 1 μg of miR-28 mimic or miR-28 inhibitor, then cells were cultured in anti-CD3e (10 μg/ml) coating plates for 72 hrs. [score:3]
However, miR-28 was found high expression in other tumors such as esophagus cancer [39], ovarian cancer [40] and renal cancer [41]. [score:3]
The miR-28 mimic can decrease the expression of the Foxp3+PD1+ T cells. [score:3]
One μg of miR-28 mimic/miR-28 inhibitor (controls, Qiagen #SI03650318 and #1027271) was added to 50 μl of Opti-MEM. [score:3]
The Foxp3+PD1+ (Figure 7B) and Foxp3+TIM3+ cells (Figure 7C) were increased after transfected with miR-28 inhibitor. [score:3]
To clarify whether miR-28 is involved in the process of exhaustive differentiation of Treg cells, T cells isolated from spleen of B16F10-bearing mice, after transfected with miR-28 mimic or inhibitor in vitro with anti-CD3e coating plates, flow cytometry was used detected the conventional CD4+CD25+Foxp3+ Treg, as well as “exhaustive” Foxp3+PD1+ and Foxp3+TIM3+ Treg cells (Figure 7). [score:3]
Among the 11 miRNAs confirmed by RT-qPCR, miR-28 have significant complementarity to the 3’UTR of all 3 inhibitory immunoreceptor theoretically (Figure 3A). [score:3]
In our study, miR-28 was proved beneficial to inhibit T cells exhaustion. [score:3]
On the contrary, when transfected with miR-28 inhibitor, the PD1+ or TIM3+ T cells were increased both in the CD4+ (Figure 6A, 6B) and CD8+ T cells (Figure 6D, 6E). [score:3]
Alteration of exhaustive phenotype of T cells after transfection of miR-28 mimic and miR-28 inhibitor. [score:3]
In this study, we found that the presence of miR-28 inhibitor can induce the Foxp3+PD1+ and Foxp3+TIM+ Treg cell differentiation in vitro. [score:3]
Figure 7Two million lymphocytes, collected from lymph nodes of B16F10-bearing mice, were plated per well in a 24 well plate and transfected with 1 μg of miR-28 mimic or miR-28 inhibitor, then cells were cultured with anti-CD3e (10 μg/ml) coating plates for 72 hrs. [score:3]
These data indicate that miR-28 can reduce gene expression through the 3’ UTR of the PD1 gene. [score:3]
miR-28 levels were reduced in B cell lymphoma and re -expression of this miRNA leads to impaired cell proliferation through silenced MAD2L1, a component of cell cycle for mitotic spindle coordination [42]. [score:3]
The results suggested that miR-28 can regulate the generation or differentiation of exhaustive Treg. [score:2]
These data suggest that miR-28 is capable of regulating the PD1, TIM3 and BTLA genes on the T cell from melanoma-bearing mice. [score:2]
miR-28 regulating FoxP3+PD1+ and Foxp3+TIM3+ Treg cells. [score:2]
miR-28 reduced luciferase activity by 50% (Figure 3B). [score:1]
Our results indicate that miR-28 may convert the exhaustive status of T cells through recover the ability of T cell to secret cytokines such as IL-2 and TNF-α. [score:1]
After transfection with miR-28 mimic, PD1+ T cells were decreased from 38.3% to 28.21% in CD4+ T cells (Figure 6A) and from 36.91% to 28.5% in CD8+ T cells (Figure 6D), but TIM3 and BTLA had no significant decrease (Figure 6B, 6C, 6E, 6F). [score:1]
miR-28 recovering the cytokine secretion of exhausted T cells. [score:1]
miR-28, miR-150, and miR-151-5p levels in CD4+PD1+ T cells decreased by 30%, 45%, and 25%, respectively (Figure 2C). [score:1]
So miR-28 was selected as the candidate miRNA that fulfilled the objectives of this study. [score:1]
The miR-28 mimics sequence (Qiagen) transfected with the PD1 3’ UTR pmirGLO plasmid are as follows: 5’-AAGGAGCUCACAGUCUAUUGAG. [score:1]
Therefore, in accordance with in silico and the dual luciferase assay, miR-28 was chosen as a candidate to determine if a miRNA can silence PD1 and regulate T cell function. [score:1]
Based on our microarray and qPCR results, three miRNA (miR-28, miR-150, miR-151-5p) were confirmed decreased in CD4+PD1+ T cells. [score:1]
Among the three miRNA, miR-28 has potential to bind to the 3’UTR of PD1, TIM3 and BTLA. [score:1]
miR-28 manipulating exhaustive phenotype of T cells. [score:1]
It is the first time to illuminate the relationship between miR-28 and T cells in melanoma. [score:1]
miR-28 modulating cytokine secretion of exhaustive T cells. [score:1]
Our research, for the first time, found that miR-28 can manipulating the secretion of cytokines from exhausted T cells. [score:1]
Addition of miR-28 mimics increase the level of IL-2 and TNF-α of T cells, suggesting another benefit of miR-28 that may restore the cytokine secretion function of exhausted T cells in tumor. [score:1]
These results highlighted that miR-28 can convert the exhaustive phenotype of PD1+ T cells. [score:1]
miR-28 modulating FoxP3+PD1+ and Foxp3+TIM3+ Treg cells. [score:1]
B16F10 cells were used to transfect the dual luciferase plasmids with miR-28 mimic or control miRNA, cells were collected and analyzed for firefly and renilla luciferase activity 24 hrs later. [score:1]
Most of researches were concerned about miR-28 and cancer cells in the past. [score:1]
An dual luciferase assay was conducted for PD1 3’UTR and demonstrated that miR-28 can directly silence PD1 through binding to its 3’UTR, melanoma cell line B16F10 were choose for the luciferase experiment, the cell line are easier to transfected and the results are more stabilized. [score:1]
B16F10 cells were transfected with the PD1 3’ UTR dual luciferase plasmid and miR-28 mimic. [score:1]
The theoretical bindings sites for miR-28 on the 3’ UTR of PD1, BTLA and TIM3. [score:1]
[1 to 20 of 62 sentences]
2
[+] score: 113
Inhibitors for miR-7b and miR-28 upregulated CRX expression as expected (Fig.   3A,B), while miR-543 inhibitor did not upregulate CRX (Fig.   3C) and so was excluded from further analysis. [score:13]
Knockdown of CRX by siRNA blocked the expression of CRX and Rhodospin upregulated by anti-miR-28, indicating that anti-miR-28 induced photoreceptor commitment of MGDPs by targeting CRX. [score:9]
The expression of CRX protein upregulated by anti-miR-28 was also partly blocked by CRX siRNA (Fig.   S1) and Rhodopsin protein was not detected (data was not shown), indicating that anti-miR-28 could have a potential to drive MGDPs to photoreceptor differentiation by targeting CRX, but more experiments are necessary to confirm its role in differentiation. [score:8]
When we transfected MGDPs with miR-7b, miR-28, miR-543 mimics and their respective inhibitors (MmiR-AN1287-SN-10, MmiR-AN0622-SN-10, MmiR-AN0362-SN-10, respectively), all three miRNA mimics suppressed CRX expression. [score:7]
Expression levels of mRNAs encoding the photoreceptor markers CRX (Fig.   6A) and Rhodopsin (Fig.   6B) were enhanced by miR-28 inhibition and suppressed by miR-28 mimic as assessed by real-time PCR. [score:7]
The expression of CRX and Rhodopsin protein were blocked by CRX siRNA, suggesting anti-miR-28 induced MGDPs to differentiate into photoreceptors commitment by targeting CRX. [score:5]
In conclusion, anti-miR-28 potentially induce MGDPs to differentiate to photoreceptor commitment by targeting CRX, suggesting a new view of facilitating Müller glia as seed cells for photoreceptor regeneration in retinal degenerative diseases. [score:5]
When respective miRNA mimics were transiently transfected to MGDPs for 2 days, real-time polymerase chain reaction (PCR) demonstrated that only 3 miRNAs, miR-7b, miR-543, and miR-28, suppressed CRX expression (Table  1). [score:5]
Furthermore, transfection of miR-28 inhibitor via lentivirus into MGDPs potentially facilitated commitment to the photoreceptor lineage as evidenced by increased expression of Rhodopsin and CRX. [score:5]
Retinal Müller glia are also knows as one of endogenous stem cells and could be induced to photoreceptor phenotypes by upregulation of CRX regulated by anti-miR-28 as demonstrated in our study. [score:5]
We demonstrated that anti-miR-28 potentially induced photoreceptor lineage commitment of MGDPs as evidenced by neuron-like morphological changes and upregulation of the photoreceptor markers CRX and rhodopsin at both the mRNA and protein levels. [score:4]
We similarly demonstrated that anti-miR-28 potentially induced photoreceptor lineage commitment of MGDPs, which further proved the viewpoint that distinct miRNAs must be down-regulated to generate the latest neuron types [32]. [score:4]
The mouse pre-miR-28 sequence was amplified from genomic DNA of mouse fibroblasts and cloned into the lentivirus expression vector mU6-MCS-Ubi-EGFP (provided by Gene, China). [score:3]
CRX gene expression measured by qPCR in cells transfected with miR-7b, miR-543, or miR-28 mimic (left panels) or corresponding inhibitors (right panels). [score:3]
For 7 days of differentiation, some MGDPs transfected with miR-28 inhibitor exhibited neuronal features, including condensed cytoplasm, one or more synaptic processes, and reduced cytoplasm:nucleus ratio (Fig.   5C), consistent with Jayaram H [20]. [score:3]
MGDPs were divided into four groups: A (control group with no lentivirus transfection), B (empty vector group transfected with lentivirus mU6-MCS-Ubi-EGFP), C (miR-28-overexpression group transfected with lentivirus mU6-MCS-Ubi-miR-28-EGFP), and D (anti-miR-28 group transfected with lentivirus mU6-MCS-Ubi-anti-miR-28-EGFP). [score:3]
To study the effects of miR-28 -mediated CRX modulation on differentiation of MGDPs, MGDPs isolated from passage 2 neurospheres were infected with lentivirus containing miR-28 mimic or inhibitor. [score:3]
293T cells were transfected with lentiviral plasmid (empty EGFP control, miR-28, or miR-28 inhibitor), as well as lentiviral packaging plasmids including pLP1 and pLP2 using the FuGENE [®] HD transfection reagent (Roche). [score:3]
These searches identified 8 miRNAs (miR-7a, miR-7b, miR-28, miR-186, miR-381, miR-876, miR-543, and miR-708) that might target CRX. [score:3]
By computer bioinformatics, gain/loss-of-function mo dels and luciferase reporter assays, one identified miRNA, miR-28, was validated to target CRX. [score:2]
MiR-28 targeted CRX. [score:2]
Primers used for amplification were as follows: Mmu-miR-28-5p -inhibitor, forward 5′-AAGGAGCTCACAGTCTATTGAG-3′ and reverse 5′-CTCAATAGACTGTGAGCTCCTT-3′; miR-28, 5′-ATTGAGTTGCCTTTCTGATT CTCCCACTAGATTGTGAGCTGCTGGAGGGCAGGCACT-3′ and reverse 5′-AGTGCCTGCCCTCCAGC AGCTCACAATCTAGTGGGAGAATCAGAAAGGCAACTCAATAGACTGTGAGCTCC TTGAAGGTAGGGACC -3′. [score:2]
Figure 4Dual–luciferase reporter assays domenstrated that CRX was target by miR-28. [score:2]
Therefore, we selected miR-28 for further study on MGDP differentiation. [score:1]
miR-28 potentially induced photoreceptor commitment of mice MGDPs. [score:1]
MGDPs transfected with lentivirus mU6-MCS-Ubi-anti-miR-28-EGFP or mU6-MCS-Ubi-EGFP for 3 days were again transfected with siRNA harbouring no 3′UTR of CRX (5′-GCATCTCAGATTCTTACAG-3′, Genechem, China) or its negative control siRNA (si-NC) using lipofectamine 2000 (Invitrogen, USA) according to the manufacture’s recommendation. [score:1]
control miR-7b mimcs CRX 1.005 ± 0.090.43 ± 0.04 [*] miR-7b 1.00 ± 0.042.62 ± 0.16 [*] Con miR-186 mimics CRX 1.05 ± 0.14 1.07 ± 0.09 miR-186 1.00 ± 0.021.25 ± 0.02 [*] Con miR-7a mimics CRX 1.02 ± 0.08 0.91 ± 0.016 miR-7a 1.01 ± 0.15 1.15 ± 0.06 Con miR-876 mimics CRX 1.00 ± 0.04 1.14 ± 0.05 miR-876 1.00 ± 0.09 1.25 ± 0. 14 Con miR-708 mimics CRX 1.00 ± 0.11 1.02 ± 0.10 miR-708 1.00 ± 0.03 0.89 ± 0.07 Con miR-381 mimics CRX 1.01 ± 0.10 1.25 ± 0.15 miR-381 1.00 ± 0.01 0.83 ± 0.09 Con miR-543 mimics CRX 1.00 ± 0.060.39 ± 0.02 [*] miR-543 1.09 ± 0.142.56 ± 0.18 [*] Con miR-28 mimics CRX 1.00 ± 0.040.36 ± 0.02 [*] miR-28 1.00 ± 0.092.08 ± 0. 10 [*] * P < 0.05. [score:1]
Our results further proved that retinal Müller glia has capacity to facilitate photoreceptor regeneration, consistent with the literatures 5, 20, but we did not go a step further to detect photoreceptor function, which was one of limits of our study, and more experiments are needed to confirm the role of anti-miR-28 in differentiation. [score:1]
To verify whether the 3′UTR of CRX was recognized by miR-28 or miR-7b, we generated luciferase reporter constructs containing a CRX 3′UTR with either wild type (wt) or mutated type of miR-28 (or miR-7b) binding sites. [score:1]
These results indicated that the putative binding site seed sequences of CRX were specifically recognized by miR-28, but not by miR-7b. [score:1]
[1 to 20 of 30 sentences]
3
[+] score: 80
Our results demonstrate that also in immortalized MEF miR-28 targets ASF/SF2 suggesting that its tumor suppressor activity is due to ASF/SF2 inhibition, although other targets cannot be excluded. [score:9]
These data indicate that the re -expression of miR-34a and miR-28 (and consequently of their controlled pathways) was sufficient to reduce the proliferative rate of immortalized MEF and suggest that miR-28, like the tumor suppressor miR-34a, could have a tumor suppressor activity. [score:7]
We have previously reported that in primary MEF miR-28 targets the proto-oncogenic splicing factor ASF/SF2 and that in turn miR-28 over -expression induces both apoptosis and senescence of primary MEF via ASF/SF2 down regulation [20]. [score:6]
We have shown in primary MEF that miR-28 targets the proto-oncogene ASF/SF2, a splicing factor involved in the alternative splicing of many transcripts [27, 28] and its over expression induces apoptosis and senescence by down regulating ASF/SF2 [20]. [score:6]
To confirm the hypothesis, we transfected immortalized MEF (p10) with miR-28 and found 50% reduction of ASF/SF2 expression (Fig. 3E), suggesting that miR-28 control cell proliferation by targeting ASF/SF2. [score:5]
We found that the expression of miR-20a, miR-21, miR-28 and miR-290, all involved in MEF senescence, were deregulated in coincidence with p21 down regulation and increase of cell proliferation. [score:5]
As expected the expression of ASF/SF2 was higher in immortalized than in primary MEF (Fig. 3D) suggesting a possible post transcriptional control of miR-28 on ASF/SF2 expression. [score:5]
The proliferation data showed that miR-20a and miR-290 did not affect cell proliferation as expected, the down regulated miR-28 and miR-34 significantly reduced the proliferation of immortalized MEF with similar efficiency, while miR-21 did not inhibit cell proliferation (Fig. 3C). [score:4]
In particular, the down regulated miR-28, behaved as a TS miRNA, when transfected in immortalized MEF, analogously to the well known TS miR-34a, indicating that the comparison of the miRNA signature of primary versus immortalized cells could allow the identification of novel miRNAs with potential tumor suppressor-like activity. [score:4]
These results strengthen the idea that miR-28 has a tumor suppressor-like activity and might be suitable to be tested in tumor cell lines defective in miR-28 content. [score:3]
The analysis showed that while miR-20a and miR-290 were down regulated till p6 (Fig 3A) miR-21 and miR-28 were up regulated. [score:3]
It is worth noting that the up regulation of miR-21 and miR-28 is in agreement with findings in MEF replicative senescence, while miR-290 down regulation is the opposite of previous observations because we have shown that miR-290 steadily increased when either spontaneous or nocodazole -induced MEF G1 blocked tetraploid cells were present [4]. [score:3]
5. MiR-28 behaves as tumor suppressor miRNA. [score:3]
Interestingly, the switch of p21 expression was accompanied by the change of the signature of miRNAs related to MEF senescence, including the p53 -dependent miR-34 and miR-28 [20]. [score:3]
In particular we demonstrate that by replacing miR-28 and miR-34a, under expressed in immortalized MEF, cell proliferation was reduced suggesting that both miRNAs are implicated in immortalization. [score:3]
The miRNA signatures changed markedly after p6: while miR-20a and miR-290 remain down regulated, although to a lesser extent, miR-21 and miR-28 switched from up to down regulation (Fig. 3A). [score:3]
Interestingly miR-28, as far as we know, is not directly linked to the p53 controlled pathways. [score:2]
The following oligonucleotides were used: p19ARF, forward (F) (5'-CATGGGTCGCAGGTTCTTG-3') and reverse (R) (5'-GCTCGCTGTCCTGG GTCTC-3'); p16, F (5'-CGACGGGCATAGCTTCAG-3') and R (5'-GCTCTGCTCTTGGGATTGG-3'); p21, F (5'-TCCACAGCGATATCCAGACA-3') and R (5'-GGACATCACCAGGATTGGAC-3'); p53, F (5'-ATGCCCATGCTACAGAGGAG-3') and R (5'-AGACTGGCCCTTCTTGGTCT-3'); GAPDH, F (5'-GCCTTCCGTGTTCCTACCC-3'), R (5'-TGCCTGCTTCACCACCTTC-3'); miR-20a, F (5'-TAAAGTGCTTATAGTGCAGGTAG-3'); miR-21, F (5'-TAGCTTATCAGACTGATGTTGA-3'), miR-28, F (5'-AAGGAGCTCACAGTCTATTGAG-3'); miR-34a, F (5'-TGGCAGTGT CTTAGCTGGTTGT-3'); miR-290, F (5'-gctaatcttctctgtatcgttccaa-3'); U6, F (5'-CGCAAGGATGACACGCAAATTC-3'). [score:1]
The fact that the replacement of miR-28 in immortalized MEF reduced cell proliferation to the same extent as miR-34a further strengthens the hypothesis that miR-28 represents a novel TS miRNA. [score:1]
Evidence in support of an anti proliferative role of miR-28 is already available. [score:1]
MiR-20a, miR-21, miR-28, miR-34, miR-290 and miR-NC (negative control) (GenePharma Shanghai, China) MEF were isolated from 13.5d mouse embryos, expanded and then replated every three days (6T3 protocol). [score:1]
Figure 3 (A) Quantification of miR-20a, miR-21, miR-28, miR-290 and miR-34a per passage normalized to that of MEF at passage 0. Dashed lines indicate the transition from passage 5 to 6. (B) phase distribution (%) of MEF from p1 to p5. [score:1]
Mature miR-20a, miR-21, miR-28, miR-34a and miR-290 were quantified using the miScript System: 1μg of total RNA was retrotranscribed with miScript Reverse Transcription Kit (Qiagen) and qRT-PCR was carried out using miScript SYBR Green PCR Kit (Qiagen). [score:1]
[1 to 20 of 23 sentences]
4
[+] score: 19
Moreover, we detected some other documented oncogenic microRNAs including miR-9 and miR-19a, and tumor suppressing microRNAs including miR-28, miR-33a, miR-34a and miR-214, as well as their targets E-cadherin, PTEN, HoxB3, Pim, KIT and FGFR1, respectively [21– 26], to figure out the Res -induced microRNA expression profile. [score:7]
Nevertheless, though we did detect significant increases of tumor suppressing microRNAs, miR-28 and miR-34a, their respective targets, HoxB3 and KIT, were not decreased, implying that miR-28-HoxB3 and miR-34a-KIT axes may not involve in the anti-CRC activities of Res. [score:5]
But we could not exclude the involvement of miR-28 and miR-34a since they may potentiate the anti-CRC effect of Res by silencing other undetermined targets which we did not detect in this study. [score:3]
showed that despite Res induced miR-28 and miR-34a (P < 0.01, Fig.   2g), their respective targets HoxB3 and KIT were not decreased during Res treatment (Fig.   2g), suggesting that Res probably had a specific effect on miR-34c-KITLG axis in CRC cells. [score:3]
f Res elevated miR-28 and miR-34a levels in HCT-116 cells; while other microRNAs remained stable. [score:1]
[1 to 20 of 5 sentences]
5
[+] score: 11
As such affector miRNAs, that act independently from the interaction of Nrf2 with Keap1, miRNAs miR-153, miR-27-a, miR-142-5p, and miR-144 regulated the Nrf2 expression in neuroblastoma cells [179], and miR-28 targeted the 3’UTR of Nrf2 mRNA decreasing Nrf2 expression in human breast cancer cells [180]. [score:8]
Yang M. Yao Y. Eades G. Zhang Y. Zhou Q. MiR-28 regulates Nrf2 expression through a Keap1-independent mechanismBreast Cancer Res. [score:3]
[1 to 20 of 2 sentences]
6
[+] score: 6
Also, MEF immortalization results in the downregulation of certain tumor suppressor miRNAs such as miR-21, miR-28 and miR-34a [20]. [score:6]
[1 to 20 of 1 sentences]
7
[+] score: 5
Other miRNAs from this paper: hsa-let-7c, hsa-let-7d, hsa-mir-16-1, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-28, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-99a, mmu-mir-101a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-128-1, mmu-mir-9-2, mmu-mir-142a, mmu-mir-144, mmu-mir-145a, mmu-mir-151, mmu-mir-152, mmu-mir-185, mmu-mir-186, mmu-mir-24-1, mmu-mir-203, mmu-mir-205, hsa-mir-148a, hsa-mir-34a, hsa-mir-203a, hsa-mir-205, hsa-mir-210, hsa-mir-221, mmu-mir-301a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-142, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-185, hsa-mir-186, mmu-mir-148a, mmu-mir-200a, mmu-let-7c-1, mmu-let-7c-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-34a, mmu-mir-148b, mmu-mir-339, mmu-mir-101b, mmu-mir-28a, mmu-mir-210, mmu-mir-221, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-128-2, hsa-mir-128-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-301a, hsa-mir-151a, hsa-mir-148b, hsa-mir-339, hsa-mir-335, mmu-mir-335, hsa-mir-449a, mmu-mir-449a, hsa-mir-450a-1, mmu-mir-450a-1, hsa-mir-486-1, hsa-mir-146b, hsa-mir-450a-2, hsa-mir-503, mmu-mir-486a, mmu-mir-542, mmu-mir-450a-2, mmu-mir-503, hsa-mir-542, hsa-mir-151b, mmu-mir-301b, mmu-mir-146b, mmu-mir-708, hsa-mir-708, hsa-mir-301b, hsa-mir-1246, hsa-mir-1277, hsa-mir-1307, hsa-mir-2115, mmu-mir-486b, mmu-mir-101c, mmu-mir-28b, hsa-mir-203b, hsa-mir-5680, hsa-mir-5681a, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, hsa-mir-486-2, mmu-mir-126b, mmu-mir-142b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
The 3p arms of miR-28 and miR-339 showed higher expressions than the corresponding 5p arms in the metastatic line, whereas they showed lower expressions than the corresponding 5p arms in the non-metastatic line. [score:5]
[1 to 20 of 1 sentences]
8
[+] score: 4
For OFSCs, the expression levels of hsa-miR-28-5p, hsa-miR-503 and hsa-miR-769-5p (transcripts per million < 1,000) were too low to act as a regulator for immunomodulation. [score:4]
[1 to 20 of 1 sentences]
9
[+] score: 4
This is the case with miR-28 where overexpression of miR-28-5p and miR-28-3p caused different effects in colorectal cancer cells (Almeida et al., 2012). [score:3]
Strand-specific miR-28-5p and miR-28-3p have distinct effects in colorectal cancer cells. [score:1]
[1 to 20 of 2 sentences]
10
[+] score: 4
Other miRNAs from this paper: hsa-mir-25, hsa-mir-28, hsa-mir-95, mmu-mir-151, mmu-mir-290a, mmu-mir-297a-1, mmu-mir-297a-2, mmu-mir-130b, mmu-mir-340, mmu-mir-25, mmu-mir-28a, hsa-mir-130b, hsa-mir-367, hsa-mir-372, hsa-mir-378a, mmu-mir-378a, hsa-mir-340, hsa-mir-151a, mmu-mir-466a, mmu-mir-467a-1, hsa-mir-505, hsa-mir-506, mmu-mir-367, hsa-mir-92b, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-648, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-659, hsa-mir-421, hsa-mir-151b, hsa-mir-1271, hsa-mir-378d-2, mmu-mir-467b, mmu-mir-297b, mmu-mir-505, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-297c, mmu-mir-421, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-467c, mmu-mir-467d, mmu-mir-92b, mmu-mir-466d, hsa-mir-297, mmu-mir-467e, mmu-mir-466l, mmu-mir-669g, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-467f, mmu-mir-466j, mmu-mir-467g, mmu-mir-467h, mmu-mir-1195, hsa-mir-548e, hsa-mir-548j, hsa-mir-1285-1, hsa-mir-1285-2, hsa-mir-1289-1, hsa-mir-1289-2, hsa-mir-548k, hsa-mir-1299, hsa-mir-548l, hsa-mir-1302-1, hsa-mir-1302-2, hsa-mir-1302-3, hsa-mir-1302-4, hsa-mir-1302-5, hsa-mir-1302-6, hsa-mir-1302-7, hsa-mir-1302-8, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-1255a, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-1268a, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-1255b-1, hsa-mir-1255b-2, mmu-mir-1906-1, hsa-mir-1972-1, hsa-mir-548q, mmu-mir-466m, mmu-mir-466o, mmu-mir-467a-2, mmu-mir-467a-3, mmu-mir-466c-2, mmu-mir-467a-4, mmu-mir-466b-4, mmu-mir-467a-5, mmu-mir-466b-5, mmu-mir-467a-6, mmu-mir-466b-6, mmu-mir-467a-7, mmu-mir-466b-7, mmu-mir-467a-8, mmu-mir-467a-9, mmu-mir-467a-10, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, hsa-mir-3116-1, hsa-mir-3116-2, hsa-mir-3118-1, hsa-mir-3118-2, hsa-mir-3118-3, hsa-mir-548s, hsa-mir-378b, hsa-mir-466, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-3156-1, hsa-mir-3118-4, hsa-mir-3174, hsa-mir-3179-1, hsa-mir-3179-2, hsa-mir-3179-3, hsa-mir-548w, hsa-mir-3156-2, hsa-mir-3156-3, hsa-mir-548x, mmu-mir-3470a, mmu-mir-3470b, mmu-mir-3471-1, mmu-mir-3471-2, hsa-mir-378c, hsa-mir-1972-2, hsa-mir-1302-9, hsa-mir-1302-10, hsa-mir-1302-11, mmu-mir-1906-2, hsa-mir-3683, hsa-mir-3690-1, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-1268b, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, mmu-mir-378b, mmu-mir-28b, hsa-mir-548ao, hsa-mir-548ap, mmu-mir-466q, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, mmu-mir-378c, mmu-mir-378d, hsa-mir-548ay, hsa-mir-548az, hsa-mir-3690-2, mmu-mir-290b, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-3179-4, mmu-mir-466c-3, hsa-mir-548bc, mmu-mir-1271
In the miR-28 network (Figure 8C), ASF/SF2 expression is modulated by miR-28 and miR-505 (not show here) which are negatively controlled by LRF to influence the proliferation and survival of mouse embryonic fibroblasts [75]. [score:3]
The functional networks of miR-92b (PRdmiR, mir-25 family, derived from GC rich tandem repeats), miR-28 (RdmiR, mir-28 family, derived from LINE), miR-151 (RdmiR, mir-28 family, derived from LINE), miR-421 (RdmiR, mir-95 family, derived from LINE), miR-1271 (RdmiR, mir-1271 family, derived from LINE), miR-340 (RdmiR, mir-340 family, derived from DNA transportable element) and miR-378 (RdmiR, mir-378 family, derived from SINE) have been reconstructed (Figure 8). [score:1]
[1 to 20 of 2 sentences]
11
[+] score: 3
A recent study reported that miR-28, miR-125b, miR-150, miR-223, and miR-382 inhibit replication of the human immunodeficiency virus (HIV) in CD4 [+] T cells [14]. [score:3]
[1 to 20 of 1 sentences]
12
[+] score: 3
Additional studies demonstrate altered miRNA expression in CNS tissue following opioid administration; miR-190 (Zheng et al., 2010a), miR-133b (Sanchez-Simon et al., 2010), miR-28, -125b, -150 and -382 (Wang et al., 2011), miR-23b and -339 (Wu et al., 2008, 2009, 2013), miR-339 (Zheng et al., 2012), miR-103 and -107 (Lu et al., 2014), miR-21 and -146a (Strickland et al., 2014), and miR-124 (Qiu et al., 2015). [score:3]
[1 to 20 of 1 sentences]
13
[+] score: 3
Yang M Yao Y Eades G Zhang Y Zhou Q MiR-28 regulates Nrf2 expression through a Keap1-independent mechanismBreast Cancer Res. [score:3]
[1 to 20 of 1 sentences]
14
[+] score: 3
In addition, Nrf-2 has been recently demonstrated to be regulated by miR-28 in non-neuronal mo dels, and miR-144, 153, 27a and 142–5p in neurons [17– 19]. [score:2]
Endogenous level of miR-28, 142–5p and 144 showed no obvious change between GSCs and non-GSCs glioma cells. [score:1]
[1 to 20 of 2 sentences]
15
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-22, hsa-mir-28, hsa-mir-29b-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-145a, mmu-mir-150, mmu-mir-10b, mmu-mir-195a, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-206, mmu-mir-143, hsa-mir-10a, hsa-mir-10b, hsa-mir-199a-2, hsa-mir-217, hsa-mir-218-1, hsa-mir-223, hsa-mir-200b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-150, hsa-mir-195, hsa-mir-206, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-22, mmu-mir-29c, rno-let-7d, rno-mir-329, mmu-mir-329, rno-mir-331, mmu-mir-331, rno-mir-148b, mmu-mir-148b, rno-mir-135b, mmu-mir-135b, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-17, mmu-mir-28a, mmu-mir-200c, mmu-mir-218-1, mmu-mir-223, mmu-mir-199a-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7b, mmu-mir-217, hsa-mir-29c, hsa-mir-200a, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-135b, hsa-mir-148b, hsa-mir-331, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-10a, rno-mir-10b, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-22, rno-mir-28, rno-mir-29b-1, rno-mir-29c-1, rno-mir-124-3, rno-mir-124-1, rno-mir-124-2, rno-mir-133a, rno-mir-143, rno-mir-145, rno-mir-150, rno-mir-195, rno-mir-199a, rno-mir-200c, rno-mir-200a, rno-mir-200b, rno-mir-206, rno-mir-217, rno-mir-223, dre-mir-7b, dre-mir-10a, dre-mir-10b-1, dre-mir-217, dre-mir-223, hsa-mir-429, mmu-mir-429, rno-mir-429, mmu-mir-365-2, rno-mir-365, dre-mir-429a, hsa-mir-329-1, hsa-mir-329-2, hsa-mir-451a, mmu-mir-451a, rno-mir-451, dre-mir-451, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-10b-2, dre-mir-16a, dre-mir-16b, dre-mir-16c, dre-mir-17a-1, dre-mir-17a-2, dre-mir-21-1, dre-mir-21-2, dre-mir-22a, dre-mir-22b, dre-mir-29b-1, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-143, dre-mir-145, dre-mir-150, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-206-1, dre-mir-206-2, dre-mir-365-1, dre-mir-365-2, dre-mir-365-3, dre-let-7j, dre-mir-135b, rno-mir-1, rno-mir-133b, rno-mir-17-2, mmu-mir-1b, dre-mir-429b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, rno-mir-133c, mmu-mir-28b, hsa-mir-451b, mmu-mir-195b, mmu-mir-133c, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, rno-let-7g, rno-mir-29c-2, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
Spinal cord miR-28, miR-217, miR-218-1, miR-329, miR-331. [score:1]
Olfactory bulb let-7b, let-7c-1, let-7c-2, miR-10a, miR-16, miR-17, miR-21, miR-22, miR-28, miR-29c, miR-124a-1, miR-124a-3, miR-128a, miR-135b, miR-143, miR-148b, miR-150, miR-199a, miR-206, miR-217, miR-223, miR-29b-1, miR-329, miR-331, miR-429, miR-451. [score:1]
[1 to 20 of 2 sentences]
16
[+] score: 1
Moreover, IL-34 modulates HCC metastasis through microRNA-28 [32]. [score:1]
[1 to 20 of 1 sentences]
17
[+] score: 1
These are mir-17, mir-22, mir-28, mir-32, mir-128b, mir-135b, mir-143, mir-151, mir-181b-2, mir-205, mir-213, mir-216 and mir-372. [score:1]
[1 to 20 of 1 sentences]
18
[+] score: 1
[55] miR-144, miR-28, miR-200 and miR-34 have all been shown to fine tune the Nrf2 pathway. [score:1]
[1 to 20 of 1 sentences]