sort by

6 publications mentioning hsa-mir-4530

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-4530. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 24
Among them, the expression patterns of 7 up-regulated (hsa-miR-4530, hsa-miR-4492, hsa-miR-6125, hsa-miR-494-3p, hsa-miR-638, hsa-miR-6743-5p, hsa-miR-4459) and 1 down-regulated miRNA (hsa-miR-4443) were consistent with the microarray data. [score:9]
8 of the most significantly up-regulated miRNAs (hsa-miR-4530, hsa-miR-4492, hsa-miR-4505, hsa-miR-6125, hsa-miR-494-3p, hsa-miR-638, hsa-miR-6743-5p and hsa-miR-4459) and 3 of the most significantly down-regulated microRNAs (hsa-miR-29a-3p, hsa-miR-4443, hsa-miR-27b-5p) were selected as representatives for confirmation. [score:7]
The expressions of hsa-miR-4530, hsa-miR-4492, hsa-miR-6125, hsa-miR-494-3p, hsa-miR-638, hsa-miR-6743-5p, hsa-miR-4459 and hsa-miR-4443 detected by qRT-PCR were consistent with the microarray data. [score:3]
As shown in Figure  4, the expressions of hsa-miR-4530, hsa-miR-4492, hsa-miR-6125, hsa-miR-494-3p, hsa-miR-638, hsa-miR-6743-5p, hsa-miR-4459 and hsa-miR-4443 detected by qRT-PCR were consistent with the microarray data with significance (P < 0.05). [score:3]
Hsa-miR-4530 was validated as a miRNA marker that differentiated pancreato-biliary cancers from other clinical conditions including healthy controls, non-malignant abnormalities, and other types of cancers [20]. [score:1]
But all of the 8 miRNAs including hsa-miR-4530, hsa-miR-4492, hsa-miR-6125, hsa-miR-494-3p, hsa-miR-638, hsa-miR-6743-5p, hsa-miR-4459 and hsa-miR-4443 were found to be related with EV71 infection for the first time. [score:1]
[1 to 20 of 6 sentences]
2
[+] score: 9
hsa-miR-197-5p (MIMAT0022691) CGGGUAGAGAGGGCAGUGGGAGG 2102555 hsa-miR-33b-3p (MIMAT0004811) CAGUGCCUCGGCAGUGCAGCCC 204462 hsa-miR-3960 (MIMAT0019337) GGCGGCGGCGGAGGCGGGGG 2100264 hsa-miR-4443 (MIMAT0018961) UUGGAGGCGUGGGUUUU 2104824 hsa-miR-4455 (MIMAT0018977) AGGGUGUGUGUGUUUUU 2105370 hsa-miR-4515 (MIMAT0019052) AGGACUGGACUCCCGGCAGCCC 2118009 hsa-miR-762 (MIMAT0010313) GGGGCUGGGGCCGGGGCCGAGC 2114944 hsa-miR-940 (MIMAT0004983) AAGGCAGGGCCCCCGCUCCCC 204094 hsa-miR-4530 (MIMAT0019069) CCCAGCAGGACGGGAGCG 2105012 hsa-miR-486-5p (MIMAT0002177) UCCUGUACUGAGCUGCCCCGAG 204001 hsa-miR-630 (MIMAT0003299) AGUAUUCUGUACCAGGGAAGGU 204392 cel-miR-39 (MIMAT0000010) UCACCGGGUGUAAAUCAGCUUG 203952 Using an miRWalk 1.0 online tool, target genes of differentially expressed miRNAs were further co-predicted with miRWalk, Targetscan, miRanda, PICTAR2, and DIANAmT software programs. [score:7]
Only 7 of 11 miRNAs, including miR-33b-3p, miR-940, miR-4443, miR-4530, miR-4739, miR-486-5p, and miR-3960, were stably detected in all 4 groups (Figure 1). [score:1]
Figure 2Comparison of the serum levels of miR-33b-3p (A), miR-940 (B), miR-486-5p (C), miR-4443 (D), miR-3960 (E), miR-4530 (F), and miR-4739 (G) in subclinical hypothyroidism (SCH) + spontaneous abortion (SA), SCH, SA, and healthy control (HC) groups. [score:1]
[1 to 20 of 3 sentences]
3
[+] score: 7
A study by Xun et al. show that the expression level of miR-4530 [72] and miR-296-5p are most differentially up-regulated in enterovirus 71 (EV71) infections [73]. [score:6]
Indeed, some miRNAs that have been previously linked to carcinogenesis of different organs and tissues, such as miR-2861 [47, 48], miR-4530 [49], miR-638 [50], miR-371b-5p [51], miR-1225-5p [52, 53], miR-296-5p [54, 55], miR-4787-5p [56], miR-4281 [57], miR-4455 [58], miR-197-3p [59], miR-369-5p [60, 61] and miR-505-3p [62] which were found to be altered in brucellosis in our analysis. [score:1]
[1 to 20 of 2 sentences]
4
[+] score: 6
Five (miR-155-5p, 665, 19b-3p, 146b-5p, and 543) of the 15 miRNAs were upregulated, and the other 10 miRNAs (miR-4530, 4430, 4271, 3177-3p, 4732-5p, 6886-5p, 4640-5p, 6847-5p, 601, and 4497) were downregulated in the cytokine group compared with the normal group. [score:6]
[1 to 20 of 1 sentences]
5
[+] score: 3
Eleven miRNAs (miRNA-4530, miRNA-4739, miRNA-762, miRNA-4787-5p, miRNA-940, miRNA-3676-5p, miRNA-6090, miRNA-150-5p, miRNA-4516, miRNA-4284, miRNA-3656) demonstrated a similar expression trend in both the acute and chronic groups. [score:3]
[1 to 20 of 1 sentences]
6
[+] score: 2
Six of 16 (miR-4530, -4428, -6124, -4459, -1915-3p, and -4270) occupied a central position in the regulation of inflammatory processes (Figure 3). [score:2]
[1 to 20 of 1 sentences]