sort by

10 publications mentioning hsa-mir-1972-2

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-1972-2. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 10
Six miRNAs were overexpressed (hsa-miR-193a-3p, hsa-miR-29b-1-5p, hsa-miR-505-5p, hsa-miR-194-5p, hsa-miR-99b-3p, and hsa-miR-200b-3p) and 14 (hsa-miR-3663-3p, hsa-miR-513a-5p, hsa-miR-146b-5p, hsa-miR-1972, hsa-miR-718, hsa-miR-3138, hsa-miR-21-5p, hsa-miR-630, hsa-miR-575, hsa-miR-301a-3p, hsa-miR-636, hsa-miR-34a-3p, hsa-miR-21-3p, and hsa-miR-516a-5p) were downregulated in aortic tissue from AS patients (Table 2). [score:6]
Six overexpressed miRNAs (hsa-miR-193a-3p, hsa-miR-29b-1-5p, hsa-miR-505-5p, hsa-miR-194-5p, hsa-miR-99b-3p, and hsa-miR-200b-3p) and 14 downregulated miRNAs (hsa-miR-3663-3p, hsa-miR-513a-5p, hsa-miR-146b-5p, hsa-miR-1972, hsa-miR-718, hsa-miR-3138, hsa-miR-21-5p, hsa-miR-630, hsa-miR-575, hsa-miR-301a-3p, hsa-miR-636, hsa-miR-34a-3p, hsa-miR-21-3p, and hsa-miR-516a-5p) were identified in patients with AS, relative to normal controls, and their general characteristics and functional annotations were analyzed using bioinformatic tools. [score:4]
[1 to 20 of 2 sentences]
2
[+] score: 7
However, some of the miRNAs found to be upregulated in PBMCs of patients with major depressive disorder (MDD), such as hsa-miRNA-26b and hsa-miRNA-1972 [54] are not upregulated in our cohort of FM patients (GEO datasets GSE65033 (http://www. [score:7]
[1 to 20 of 1 sentences]
3
[+] score: 6
of Reads hsa-miR-1972 ENST00000547850 184 GTGCTGGGATTACAGGCGTGAGC 3 ENST00000547850 280 TTTTGAGACGGAGTCTCG 2 ENST00000547850 304 CCCAGGCTGGAGTGCAGTGGC 2 ENST00000547850 304 CCCAGGCTGGAGTGCAGTGG 2 ENST00000547850 306 CAGGCTGGAGTGCAGTGGC 4 hsa-miR-5096 ENST00000409982 785 GGTGGATCACCTGAGGTCAGGAGT 2 ENST00000409982 791 TCACCTGAGGTCAGGAGT 24 ENST00000409982 902 ACTTGGGAGGCTGAGGCA 2 ENST00000409982 904 TTGGGAGGCTGAGGCAGGAGAATC 2 ENST00000409982 904 TTGGGAGGCTGAGGCAGGAGAA 2 ENST00000409982 906 GGGAGGCTGAGGCAGGAG 3 ENST00000409982 907 GGAGGCTGAGGCAGGAGAATCGCT 2 ENST00000409982 915 AGGCAGGAGAATCGCTTGAAC 2 Figure 1Ta-siRNAs with specific targets site in brain. [score:3]
of Reads hsa-miR-1972 ENST00000547850 184 GTGCTGGGATTACAGGCGTGAGC 3 ENST00000547850 280 TTTTGAGACGGAGTCTCG 2 ENST00000547850 304 CCCAGGCTGGAGTGCAGTGGC 2 ENST00000547850 304 CCCAGGCTGGAGTGCAGTGG 2 ENST00000547850 306 CAGGCTGGAGTGCAGTGGC 4 hsa-miR-5096 ENST00000409982 785 GGTGGATCACCTGAGGTCAGGAGT 2 ENST00000409982 791 TCACCTGAGGTCAGGAGT 24 ENST00000409982 902 ACTTGGGAGGCTGAGGCA 2 ENST00000409982 904 TTGGGAGGCTGAGGCAGGAGAATC 2 ENST00000409982 904 TTGGGAGGCTGAGGCAGGAGAA 2 ENST00000409982 906 GGGAGGCTGAGGCAGGAG 3 ENST00000409982 907 GGAGGCTGAGGCAGGAGAATCGCT 2 ENST00000409982 915 AGGCAGGAGAATCGCTTGAAC 2 Figure 1Ta-siRNAs with specific targets site in brain. [score:3]
[1 to 20 of 2 sentences]
4
[+] score: 4
CNV region position genotypes CNV ID functional relevance expression (mimiRNA/[18] ) conservation mir-1268 chr15:20014593-20014644 chr15:19803370-20089386 2,3,4,5,6 20571) recurrently deleted in classical Hodgkin's lymphoma [47] not reported/NA primates mir-1233 chr15:32607783-32607864 chr15 chr15:32487975-32617680 0,1,2,3 2082 1) not reported/NA primates mir-1972 chr16:15011679-15011755 chr16 chr16:14897364-15016088 2,3,4 2141 not reported/NA primates mir-384 chrX:76056092-76056179 chrX:76053855-76057477 0,1,2 2648 in several tissues/NA mammals miRNAs localized in 'polymorphic-DC' CNV regions miRNA ID miRNA position dupl. [score:3]
Among the identified miRNA-CNVs, we found deletions (e. g., hsa-mir-384 and hsa-mir-1324), duplications (e. g., hsa-mir-1972 and hsa-mir-1977), and multiple duplications (multiallelic polymorphisms; e. g., hsa-mir-1233 and hsa-mir-1268). [score:1]
[1 to 20 of 2 sentences]
5
[+] score: 4
Eleven of the up-regulated miRNAs (miR-887, miR-583, miR-662, miR-1973, miR-718, miR-1268, miR-2117, miR-614, miR-617, miR-1972, and miR-1181) have no reported functions in cancer cells yet. [score:4]
[1 to 20 of 1 sentences]
6
[+] score: 3
Although eight miRNAs (hsa-miR-762, hsa-miR-93-5p, hsa-miR-20a-5p, hsa-miR-3192-5p, hsa-miR-1294, hsa-miR-1972, hsa-miR-106b-5p and hsa-miR-526b-3p) were predicted by all 5 databases, we found that only one gene (TCF3) has a miRNA-target interaction. [score:3]
[1 to 20 of 1 sentences]
7
[+] score: 2
While 44 miRNAs showed a greater enrichment in the cytosolic Hy3-labeled RNA fraction, 13 miRNAs were significantly and reproducibly enriched in the mitochondrial Hy5-labeled RNA sample (ranging from 1.5- to 56-fold), namely hsa-miR-1973, hsa-miR-1275, hsa-miR-494, hsa-miR-513a-5p, hsa-miR-1246, hsa-miR-328, hsa-miR-1908, hsa-miR-1972, hsa-miR-1974, hsa-miR-1977, hsa-miR-638, hsa-miR-1978 and hsa-miR-1201 (Figure 5A). [score:1]
hsa-miR-1972 (1) Chr16: 151041224–15104246 (−) (1) 16q13.11 Intragenic Localization (1): None. [score:1]
[1 to 20 of 2 sentences]
8
[+] score: 2
Other miRNAs from this paper: hsa-mir-25, hsa-mir-28, hsa-mir-95, mmu-mir-151, mmu-mir-290a, mmu-mir-297a-1, mmu-mir-297a-2, mmu-mir-130b, mmu-mir-340, mmu-mir-25, mmu-mir-28a, hsa-mir-130b, hsa-mir-367, hsa-mir-372, hsa-mir-378a, mmu-mir-378a, hsa-mir-340, hsa-mir-151a, mmu-mir-466a, mmu-mir-467a-1, hsa-mir-505, hsa-mir-506, mmu-mir-367, hsa-mir-92b, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-648, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-659, hsa-mir-421, hsa-mir-151b, hsa-mir-1271, hsa-mir-378d-2, mmu-mir-467b, mmu-mir-297b, mmu-mir-505, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-297c, mmu-mir-421, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-467c, mmu-mir-467d, mmu-mir-92b, mmu-mir-466d, hsa-mir-297, mmu-mir-467e, mmu-mir-466l, mmu-mir-669g, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-467f, mmu-mir-466j, mmu-mir-467g, mmu-mir-467h, mmu-mir-1195, hsa-mir-548e, hsa-mir-548j, hsa-mir-1285-1, hsa-mir-1285-2, hsa-mir-1289-1, hsa-mir-1289-2, hsa-mir-548k, hsa-mir-1299, hsa-mir-548l, hsa-mir-1302-1, hsa-mir-1302-2, hsa-mir-1302-3, hsa-mir-1302-4, hsa-mir-1302-5, hsa-mir-1302-6, hsa-mir-1302-7, hsa-mir-1302-8, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-1255a, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-1268a, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-1255b-1, hsa-mir-1255b-2, mmu-mir-1906-1, hsa-mir-1972-1, hsa-mir-548q, mmu-mir-466m, mmu-mir-466o, mmu-mir-467a-2, mmu-mir-467a-3, mmu-mir-466c-2, mmu-mir-467a-4, mmu-mir-466b-4, mmu-mir-467a-5, mmu-mir-466b-5, mmu-mir-467a-6, mmu-mir-466b-6, mmu-mir-467a-7, mmu-mir-466b-7, mmu-mir-467a-8, mmu-mir-467a-9, mmu-mir-467a-10, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, hsa-mir-3116-1, hsa-mir-3116-2, hsa-mir-3118-1, hsa-mir-3118-2, hsa-mir-3118-3, hsa-mir-548s, hsa-mir-378b, hsa-mir-466, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-3156-1, hsa-mir-3118-4, hsa-mir-3174, hsa-mir-3179-1, hsa-mir-3179-2, hsa-mir-3179-3, hsa-mir-548w, hsa-mir-3156-2, hsa-mir-3156-3, hsa-mir-548x, mmu-mir-3470a, mmu-mir-3470b, mmu-mir-3471-1, mmu-mir-3471-2, hsa-mir-378c, hsa-mir-1302-9, hsa-mir-1302-10, hsa-mir-1302-11, mmu-mir-1906-2, hsa-mir-3683, hsa-mir-3690-1, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-1268b, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, mmu-mir-28c, mmu-mir-378b, mmu-mir-28b, hsa-mir-548ao, hsa-mir-548ap, mmu-mir-466q, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, mmu-mir-378c, mmu-mir-378d, hsa-mir-548ay, hsa-mir-548az, hsa-mir-3690-2, mmu-mir-290b, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-3179-4, mmu-mir-466c-3, hsa-mir-548bc, mmu-mir-1271
Some larg families, the mir-506, mir-1972, mir-3118 and mir-3179 families are primate-specific. [score:1]
Examples of this are the mir-297, mir-466, mir-467, mir-548 [16], mir-1302 [20], mir-1972, mir-3118 and mir-3179 families (which are all RrmiR families listed here) (Table S5). [score:1]
[1 to 20 of 2 sentences]
9
[+] score: 1
Other miRNAs from this paper: hsa-mir-18a
So far SNPs in the region of ESR1, CCDC170, EBF1, LSP1, MIR1972-2:FTO, RAD51L1, ZNF365, MKL1, TNRC9/TOX 3, NTN4, NEK10, TAB2 and loci at 2p24.1 and 12q24 [8– 14] have all been identified as having a significant association with MD. [score:1]
[1 to 20 of 1 sentences]
10
[+] score: 1
Hsa_circ_0001649 may play a role in tumorigenesis and metastasis of HCC through sponge-like activity toward several miRNAs, including miR-1283, miR-4310, miR-182-3p, miR-888-3p, miR-4502, miR-6811, miR-6511b-5p, and miR-1972 [127]. [score:1]
[1 to 20 of 1 sentences]