sort by

17 publications mentioning sja-mir-71b

Open access articles that are associated with the species Schistosoma japonicum and mention the gene name mir-71b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 157
By contrast, in the up-regulated genes of 23DSI, the predicted target genes of miR-1-miR-71-miR-7-miR-7-5p appeared to regulate the ribonucleoprotein complex assembly, cellular protein complex assembly, microtubule -based process, response to oxidative stress, multicellular organismal aging, respiratory electron transport chain, pyrimidine ribonucleoside triphosphate biosynthetic process, positive regulation of epithelial cell differentiation, positive regulation of cell proliferation, apoptosis, energy coupled proton transport, electron transport chain, ATP synthesis-coupled proton transport, anatomical structure formation involved in morphogenesis, ribonucleoprotein complex biogenesis, mitotic cell cycle, larval development, microtubule polymerisation or depolymerisation, female gamete generation, regulation of transcription from RNA polymerase II promoter, and imaginal disc development, among others (Table  2 and Additional file 6: Table S4). [score:12]
In 23 DSI, the high level of bantam and low levels of miR-1, miR-71, miR-7, and miR-7-5p possibly regulated and organised a specific gene expression profile for sexual maturation and egg production by inhibiting and strengthening specific gene expression and metabolic processes. [score:8]
In unpaired females (23SSI), bantam was notably not up-regulated, whereas miR-1, miR-71, miR-7, and miR-7-5p were significantly up-regulated. [score:7]
Furthermore, among all samples, bantam was distinctly up-regulated in 23 DSI, and miR-1, miR-71, miR-7-5p, and miR-7 were distinctly up-regulated in 23SSI. [score:7]
To analyse the effect of the differential expression of miRNAs on female development after pairing, we sequenced the libraries of 23DSI and 23SSI, predicted the target genes of miRNA-1-miRNA-71-miRNA-7-miR-7-5p (Additional file 3: Table S1) and bantam (Additional file 4: Table S2), and analysed the differential expression of these genes in 23DSI compared with 23SSI. [score:7]
We found that the target genes of miR-1-miR-71-miR-7-miR-7-5p, such as ribosomal protein genes (CAX72037.1, CAX71939.1, CAX78482.1, CAX77178.1, AAP06483.1, CAX77387.1, CAX72859.1, CAX70956.1, CAX71543.1, CAX83047.1, CAX70121.1) (Additional file 6: Table S4), thioredoxin peroxidase (CAX75860.1), tubulin (XP_002580033.1, CAX75788.1, CAX75500.1, CAX71989.1, CAX76110.1), ATP synthase- H + transporting (CAX75390.1, CAX76063.1), and cytochrome c oxidase (CAX74747.1, CAX76589.1), among others, were significantly up-regulated. [score:6]
These results suggested that high-abundance miRNAs such as miR-1c, miR-1a, miR-10-5p, miR-71b-5p, and let-7 were closely related to the development of 18 d-old females before pairing, whereas during the development from 18 d to 23 d, all of these high-abundance miRNAs were down-regulated not only in 23 DSI, but also in 23SSI. [score:6]
Predicted target genes of miR-1-miR-71-miR-7-miR-7-5p in up-regulated genes in 23DSI. [score:6]
By contrast, in paired females (23DSI), the above mentioned miRNAs were not up-regulated, suggesting that the functions of the target genes of miR-1-miR-71-miR-7-miR-7-5p were required in paired females. [score:6]
Click here for file Predicted target genes of miR-1-miR-71-miR-7-miR-7-5p in up-regulated genes in 23DSI. [score:6]
Similar miRNA profiles were observed in 18SSI and 18DSI, with the presence of identically expressed high-abundance miRNA, such as miRNA-1, miRNA-71b-5p and let-7. By contrast, in 23DSI and 23SSI, most of these high-abundance miRNAs were down-regulated. [score:6]
Although miRNAs do not regulate all genes in organisms, evidence provided by miRNA analyses in the present study indicated that pairing likely limited the expression of non-essential genes through increasing the expression of bantam and specific genes by maintaining miR-1, miR-71, miR-7, and miR-7-5p at relatively low levels. [score:6]
revealed that in unpaired females, the highly-expressed miRNA-1, miRNA-71, miRNA-7, and miR-7-5p only inhibited the limited pathways, such as proteasome and ribosome assembly. [score:5]
For instance, in ribosome assembly, 15 of 49 detected genes in this metabolic process were predicted as the target genes of miR-1-miR-71-miR-7-miR-7-5p, whereas only 1 of 49 genes was the predicted target gene of bantam (Figure  3A). [score:5]
Out of the 50 genes, 33 were the predicted target genes of bantam (Figure  3B), whereas only 2 were predicted target genes of miR-1-miR-71-miR-7-miR-7-5p. [score:5]
The predicted target genes of bantam hardly participated in the proteasome, porphyrin metabolism, ribosome, whereas more predicted target genes of miR-1-miR-71-miR-7-miR-7-5p were involved in these process. [score:5]
For example, the higher expression of bantam was observed only in 23DSI, whereas higher expression of miR-1, miR-71, miR-7-5p, and miR-7 manifested only in 23SSI (Figure  1B). [score:5]
Differential expression of the predicted target genes of bantam and miRNA-1-miRNA-71-miRNA-7-5p- miR-7 between samples from 23 DSI and 23SSI. [score:5]
Moreover, few of the predicted target genes of miR-1-miR-71-miR-7-miR-7-5p participated in the peroxisome, RNA degradation, mRNA surveillance pathway, axon guidance, basal transcription factors, apoptosis, glycerophospholipid metabolism, insulin signalling pathway, lysosome, regulation of actin cytoskeleton, and endocytosis. [score:4]
B. miR-71, with respect to 23DSI, was significantly up-regulated in 23SSI (P < 0.05). [score:4]
However, none of the predicted target genes of miR-1-miR-71-miR-7-miR-7-5p are involved the citrate cycle, gastric acid secretion, glycolysis/gluconeogenesis, protein digestion and absorption, aminoacyl-tRNA biosynthesis, fatty acid biosynthesis, and the pentose phosphate pathway. [score:3]
Click here for file Predicted target genes of miR-1-miR-71-miR-7-miR-7-5p in Schistosoma japonicum. [score:3]
In particular, nearly all high-abundance miRNAs, such as miR-1c, miR-1a, miR-10-5p, miR-71b-5p, and let-7, were down-regulated in both, compared with 18DSI or 18SSI. [score:3]
The miRNAs with high-abundance, such miRNA-1c, miRNA-1a, miRNA-1, miRNA-71b-5p, let-,7 and so on showed identical expression. [score:3]
The transcriptomes of 23DSI and 23SSI revealed that the predicted target genes of miRNA-1, miRNA-71, miRNA-7, and miR-7-5p were associated with the ribonucleoprotein complex assembly and microtubule -based process. [score:3]
Predicted target genes of miR-1-miR-71-miR-7-miR-7-5p in Schistosoma japonicum. [score:3]
To confirm the differentially expressed miRNAs in 23DSI, 23SSI, 18DSI, and 18SSI, bantam, miRNA-1, and miR-71 were selected for quantitative RT–PCR analysis. [score:3]
Only several high-abundance miRNAs differentially expressed between 23DSI and 23 SSI, such as bantam, miR-1, miR-71, miR-7, and miR-7-5p. [score:3]
In particular, various ribosomal protein genes were regulated by miR-1-miR-71-miR-7-miR-7-5p. [score:2]
Thus, the change of the abundance of miR-71 in worms maybe plays a key role in female development. [score:2]
Furthermore, the low abundance of miR-1, miR-71, miR-7, and miR-7-5p in 23DSI compared with 23SSI was likely capable of promoting specific gene expression. [score:2]
These results suggested that miR-1, miR-71, miR-7, and miR-7-5p played an essential role in regulating ribosomal assembly. [score:2]
For example, their levels of miR-1c, miR-1a, miR-1, miRNA-71b-5p, and let-7 were far lower than those in 18 DSI or 18SSI. [score:1]
We found the level of high-abundance miRNAs such as miR-1, miR-1a, miR-1c, miR-71b-5p, and let-7 to be higher in 18DSI and 18SSI than in 23DSI and 23SSI. [score:1]
Similarly, higher amount of miR-71 (Figure  2B) and miR-1 (Figure  2C) were observed in 23SSI than in 23DSI. [score:1]
Interestingly, miR-71 was located on the female W chromosome, suggesting mir-71 be involved in female sex-specific functions [51]. [score:1]
[1 to 20 of 36 sentences]
2
[+] score: 42
Interestingly, both sja-miR-71 and sja-bantam showed maximum expression in cercaria (infective stage of the parasite) and their expression then dropped quickly to nadir levels in schistosomulum following penetration of the cercaria into its host. [score:5]
Analysis of sja-let-7, sja-miR-71 and sja-bantam expression by stem-loop RT-real time PCR revealed highly stage-specific expression patterns. [score:5]
Relation of S. japonicum miRNA expression to life cycle stageUsing the modified stem-loop RT-PCR method described above, we further endeavored to determine the timing of expression patterns of miRNA sja-let-7, sja-miR-71 and sja-bantam across the life span of S. japonicum. [score:5]
Importantly, the expression of sja-miR-71 and sja-bantam peaked in cercaria and then decreased quickly to their lowest levels in schistosomulum, following host infection. [score:3]
Using the modified stem-loop RT-PCR method described above, we further endeavored to determine the timing of expression patterns of miRNA sja-let-7, sja-miR-71 and sja-bantam across the life span of S. japonicum. [score:3]
Expression of sja-miR-71 and sja-bantam were 1000-fold and 500-fold higher in cercaria than that in schistosomulum, respectively. [score:3]
In particular, sja-miR-71 and sja-bantam expression reach their peaks in the cercaria stage and then drop quickly to the nadirs in the schistosomulum stage, following penetration of cercaria into a mammalian host. [score:3]
Expression of sja-let-7, sja-miR-71 and sja-bantam were analyzed in six stages of the life cycle, i. e. egg, miracidium, sporocyst, cercaria, schistosomulum, and adult worm, by a modified stem-loop reverse transcribed polymerase chain reaction (RT-PCR) method developed in our laboratory. [score:3]
Figure S8 The amplification plot of sja-let-7, sja-mir-71, sja-bantam and alpha tubulin. [score:1]
5, 6, 7 and 8 were the amplification plot of sja-let-7, sja-mir-71, alpha tubulin and sja-bantam, respectively, using the no-RT control. [score:1]
In this study, we firstly identified five authentic miRNAs in S. japonicum by constructing and screening parasite cDNA library of size-fractionated RNAs: sja-let-7, sja-miR-71, sja-bantam, sja-miR-125 and sja-miR-new1. [score:1]
Hence, herein we have tentatively designated the five novel miRNAs from S. japonicum as sja-let-7, sja-miR-71, sja-bantam, sja-miR-125 and sja-miR-new1, respectively. [score:1]
miRNA Sequence Size (nt) S. japonicum contig (LSBI, Shanghai) a S. mansoni shortgun reads (Sanger) b Clones c Δ G° [folding] (kcal/mol e) sja-let-7 GGAGGUAGUUCGUUGUGUGGU 21 CNUS0000067197: 5856–5876 shisto12670f07: 651–671 5 −30.8 sja-miR-71 UGAAAGACGAUGGUAGUGAGA 21CNUS0000007682(-) d: 3100–3120 shisto8708d10: 353–372 1 −34.5 sja-bantam UGAGAUCGCGAUUAAAGCUGGU 22 CNUS0000021739: 2223–2244shisto5226g02(-) d: 325–346 6 −22.9 sja-miR-125 UCCCUGAGACCCUUUGAUUGUC 22 CNUS0000024724:7691–7712 Smp_contig001766:3162–3183 2 −25.6 sja-miR-new1 UCCCUGAGACUGAUAAUUGCUC 22CCON0000000380 (-) d:353325–353346:15–36 shisto8125f02.p1k 4 −29.2 alocation of the miRNA sequence within the published chromosomal sequence of S. japonicum. [score:1]
Alignments with known miRNA sequences indicated that four of the five novel S. japonicum miRNAs belong to four different metazoan miRNA families, i. e. let-7, miR-71, bantam, and miR-125 (Figure 3, S3 and S4). [score:1]
Membranes were incubated with five different biotin-labeled probes (1: sja-let-7, 2: sja-miR-71, 3: sja-bantam, 4: sja-miR-125 and 5: sja-miR-new1). [score:1]
Alignments of the miRNAs with corresponding family members indicated that four of them belong to a metazoan miRNA family: let-7, miR-71, bantam and miR-125. [score:1]
The novel miRNAs were designated as sja-let-7, sja-miR-71, sja-bantam, sja-miR-125 and sja-miR-new1, respectively. [score:1]
Thus far, no studies concerning the function of miR-71 family miRNAs have been reported. [score:1]
1, 2, 3 and 4 were the amplification plot of sja-mir-71, sja-bantam, sja-let-7 and alpha tubulin, respectively, the RT product of cercaria RNAs. [score:1]
miRNA egg miracidium sporocyst cercaria schistosomulum male adult worm female adult worm sja-let-7 1.15±0.96 0.02±0.02 0.24±0.22 5.92±4.02 0.60±0.41 0.75±0.35 0.59±0.13 sja-mir-71 8.68±5.06 3.21±2.17 4.57±0.79 1257.92±565.47 0.91±0.34 1.93±1.41 1.65±0.36 sja-bantam 4.50±2.67 1.69±0. [score:1]
[1 to 20 of 20 sentences]
3
[+] score: 14
Moreover, it has been shown that five miRNAs (miR-71, miR-71b, miR-1, miR-36, and miR-124) are the most abundant in the egg stage of S. japonicum [34], implying that these miRNAs play important roles in embryo development. [score:2]
d qRT-PCR validation of the abundance of Sja-bantam and Sja-miR-71b in the RNA isolated from S. japonicum egg EVs. [score:1]
In the present study, we observed that Sja-miR-71b and Sja-bantam are also incorporated into the EVs derived from schistosomal eggs and these miRNAs can be transferred to murine liver cells via EVs in vitro. [score:1]
b Relative level of parasite-derived miRNAs (i. e. bantam and miR-71b) in murine liver cells 20 h post-incubation with 10 μg  S. japonicum egg EVs following PBS washing. [score:1]
a qRT-PCR analysis of two of the miRNAs that are associated with S. japonicum egg EVs (i. e. Sja-miR-71b and Sja-bantam) in primary hepatocytes of infected mice at 49 dpi and 80 dpi. [score:1]
Several lines of evidence have shown that highly conserved miR-71 and bantam are packaged in parasite-derived EVs, including from H. polygyrus, B. malayi and S. mansoni, suggesting that conserved miR-71- and bantam-secretion systems might exist in helminths [24, 27, 30]. [score:1]
Moreover, egg EVs associated miRNAs (i. e. Sja-miR-71b and Sja-bantam) were detectable in the primary hepatocytes of mice infected S. japonicum. [score:1]
Although the role of miR-71 secreted by parasites remains unclear, it has been proposed to be involved in host-pathogen interactions [24, 30]. [score:1]
More importantly, we found that the parasite-specific miR-71b and bantam were present in the primary hepatocytes of S. japonicum infected mice after numerous eggs deposited in the liver. [score:1]
Then, stem-loop qRT-PCR was performed to verify the presence of Sja-bantam and Sja-miR-71b in the RNA isolated from schistosomal egg EVs (Fig.   2d). [score:1]
Fig. 4qRT-PCR analysis of the Sja-miR-71b and Sja-bantam level in primary hepatocytes of infected mice. [score:1]
qRT-PCR analysis of the treated cells demonstrated that schistosomal egg EVs associated miRNAs (bantam and miR-71b) were detectable in Hepa1-6 cells after 20 h of incubation with parasite EVs (Fig.   3b). [score:1]
b, c The PCR products of Sja-miR-71b (68 bp) and Sja-bantam (67 bp). [score:1]
[1 to 20 of 13 sentences]
4
[+] score: 14
Interestingly, these five highly expressed miRNAs, miR-71b, miR-2a, miRNA-2e-5p, miRNA-2e-3p and miR-2f, were clustered in tandem at the same genomic locus (CNUS0000011792.1) (Figure 4A), whilst other miR-71 and miR-2 family members, miR-71a, miR-2d, miR-2b, and miR-2c, were clustered at another genomic locus (CNUS0000007682.1) in an inverted orientation (Figure 4B). [score:3]
In addition, both miR-71 and some miR-2 family members in tandem are found to be clustered in a reversal direction mo del on two genomic loci, and two pairs of novel S. japonicum miRNAs were derived from sense and antisense DNA strands at the same genomic loci. [score:2]
Interestingly, five miRNAs, miR-71b, miR-2a, miRNA-2e-5p, miRNA-2e-3p and miR-2f, were clustered in tandem at the same genomic locus (CNUS0000011792.1), along with the enrichment in immature worms, implying that they might play an important role in this developmental stage by acting in a synergistic manner under the control of the same promoter. [score:2]
The result showed that some miRNA genes, including miRNA-2e-5p, miRNA-2e-3p, miR-71b, miR-2a, miR-2f, miR-124 and miR-31, tended to be enriched in immature worms, whereas miR-125, miR-8 and bantam exhibited a higher abundance in mature adults (Figure 3D), suggesting that different miRNAs could play a distinct role in different development stages. [score:2]
Moreover, schistosomes also share some known miRNAs, such as bantam, miR-36, miR-60, miR-2 and miR-71 with Arthropoda and/or Nematoda animals. [score:1]
Some miRNA genes, including miRNA-2e-5p, miRNA-2e-3p, miR-71b, miR-2a, miR-2f, miR-124 and miR-31, seem to be preferentially enriched in immature worms, whereas miR-125, miR-8 and bantam exhibited a higher abundance in mature adults (Figure 3D). [score:1]
Here only two miRNA clusters identified by this study exhibited the similar genomic structure and components consisting of miR-71 and miR-2 family members. [score:1]
It should be pointed out that the cluster of miR-2 family members were found in silkworm (Bombyx mori), however, the combination of both miR-2 and miR-71 in the same clusters was not identified in other bilaterian animals. [score:1]
More interestingly, other miR-71 and miR-2 family members, miR-71a, miR-2d, miR-2b, and miR-2c, were clustered at another genomic locus (CNUS0000007682.1) in an inverted orientation. [score:1]
[1 to 20 of 9 sentences]
5
[+] score: 13
Other miRNAs from this paper: sja-let-7, sja-mir-71a, sja-mir-1, sja-mir-36
Strong biased expression patterns of certain miRNA family members were observed, of which, the expression of sja-miR-71, sja-miR-71-5p, and sja-miR-36-3p were prominent in this pathologically-related stage. [score:5]
Combining the TPM value of miRNAs (Table S3) and Northern blot analysis (Figure 4), we found that members of the sja-miR-71 family were the most highly expressed ones in the egg stage, implying that these miRNAs may play important regulatory functions during this stage. [score:4]
Sja-miR-71, sja-miR-71-5p, and sja-miR-36-3p were suggested to play important roles in embryo development. [score:2]
A similar phenomenon was also observed in other species, such as Clonorchis sinesis, in which members from the miR-71 family accounted for one third of the reads in the adult stage [37]. [score:1]
Of the miRNAs identified, sja-miR-71b-5p, sja-miR-71, sja-miR-1, sja-miR-36-3p, and sja-124-3p were the most abundant members at the egg stage (Figure 3A). [score:1]
[1 to 20 of 5 sentences]
6
[+] score: 11
Although the expression of sja-miR-71 and sja-bantam dropped quickly in S. japonicum lung-stage schistosomulum, we observed a strong hybridization signal for both miRNAs in S. mansoni (Figure 1) [37]. [score:3]
We observed 2 miRNAs (mir-2 and mir-71) expressed in both life cycle stages tested, 7 in adult worms only (mir-4, mir-6, mir-9, mir-32, mir-125, mir-3, mir-5) and 5 in schistosomula only (mir-20, mir-18, mir-22, mir-26, Bantam). [score:3]
We also analyzed in S. mansoni the expression of the five novel miRNAs recently identified in S. japonicum (sja-let-7, sja-miR-71, sja-bantam, sja-miR-125 and sja-miR-new1) [37]. [score:3]
Forty-two sequences had at least one match with mature miRNAs from different metazoan miRNA families, such as miR-832, miR-71, miR-297, and let-7 (Table 1). [score:1]
miR-71, miR-125 and Bantam are the miRNAs identified in S. mansoni homolog to miRNAs of S. japonicum [38]. [score:1]
[1 to 20 of 5 sentences]
7
[+] score: 11
The number of targets for mir-71a and mir-71b identified here was similar to that of a previous study of S. mansoni miRNAs [11], but overall, the number and identity of targets were discordant with results from the present study. [score:5]
Moreover, the four novel miRNAs transcribed principally in male adults, including one miRNA (sha-miR-new_46) encoded on the same scaffold as the mir-71/mir-2 cluster (KL250488.1) with a CPM more than 20-times higher than that in the library derived from adult female worms, suggest male-specific roles for these miRNAs in gene regulation. [score:2]
Notably, among the female-biased transcripts were the three miRNAs, sha-mir-71b, sha-mir-2b and sha-mir-2c (encoded in a cluster on scaffold KL251164.1), whereas the related miRNAs sha-mir-71a and sha-mir-2a (encoded in a cluster on scaffold KL250488.1) did not show sex-biased transcription. [score:1]
In female worms, the most highly transcribed miRNAs were sha-mir-71a (3.6% of mapped sRNA reads), sha-mir-1 (2.0%), sha-mir-71b (0.7%), sha-mir-125b (0.7%) and sha-bantam (0.3%) (S1 Table). [score:1]
The majority (n = 38; 82.6%) of miRNAs predicted to bind 3’-UTR elements were associated with more than one gene; these miRNAs included sha-miR-450_RF00708 (104 genes), sha-miR-71a (53 genes), sha-miR-71b (43 genes), sha-miR-new_38 (39 genes) and sha-miR-new_36 (37 genes). [score:1]
These results are consistent with reports of a mir-71/mir-2 cluster duplication in S. mansoni [10, 11] and S. japonicum [14, 34] on the female-sex (W) chromosome and on one autosome (chromosome 5), and further support roles in sex-specific traits, sexual differentiation, pairing of adult worms and reproductive processes in schistosomes. [score:1]
[1 to 20 of 6 sentences]
8
[+] score: 10
In general, more miRNAs were expressed at stages other than the egg, except Sja-mir-2b and Sja-mir-71, which were constantly expressed during all stages with less than 10-fold variations (Fig. 5c). [score:5]
However, the homolog to mir-71, Sja-mir-71, was predominantly expressed in male parasites. [score:3]
Mir-71 was previously found to be expressed in the Drosophila embryo, and it was implicated in controlling cell differentiation[26]. [score:2]
[1 to 20 of 3 sentences]
9
[+] score: 7
miR-1b, miR-61 and miR-281 were highly expressed in males whereas miR-8447, miR-2f, mir-8437, miR-31, bantam, miR-2c, miR-2d, miR-71b, miR-36b and miR-755 were highly expressed in females. [score:5]
Considering the critical role that eggs play in the pathogenesis of schistosomiasis, miRNAs in schistosome eggs have also been analyzed and several miRNAs (sja-miR-71b-5p, sja-miR-71, sja-miR-1, sja-miR-36-3p, and sja-124-3p) were shown to be the most abundant in the egg stage [44]. [score:1]
In S. japonicum, Cai et al demonstrated miR-7-5p, miR-61, miR-219-5p, miR-125a, miR-125b, miR-124-3p, and miR-1 were dominant in males, while bantam, miR-71b-5p, miR-3479-5p and miR-Novel-23-5p were predominantly found in the female parasites [45]. [score:1]
[1 to 20 of 3 sentences]
10
[+] score: 6
The expression of a set of miRNAs, sja-miR-7-5p, sja-miR-61, sja-miR-219-5p, sja-miR-125a, sja-miR-125b, sja-miR-124-3p and sja-miR-1 were dominant in male worms, while sja-bantam, sja-miR-71b-5p, sja-miR-3479-5p, and sja-Novel-23-5p were predominantly found in the female parasites (Table S6 and S9). [score:3]
The differential expression pattern of these miRNAs except sja-miR-71b-5p between male and female worms was quite consistent with the TPM values of high-throughput sequencing and the qRT-PCR results. [score:3]
[1 to 20 of 2 sentences]
11
[+] score: 4
Other miRNAs from this paper: sja-let-7, sja-mir-71a, sja-mir-1, sja-mir-124
Subsequently, the same group demonstrated that miRNA-71a cluster and miRNA-71b cluster were expressed in schistosomulum, using deep sequencing and northern blotting. [score:3]
The miRNA-71 family is a conserved microRNA cluster in both S. japonicum and S. mansoni. [score:1]
[1 to 20 of 2 sentences]
12
[+] score: 3
Individually, sja-let-7, sja-miR-1 sja-miR-7-5p, sja-miR-3479-5p sja-miR-190-5p, sja-miR-71 and sja-miR-71b-5p have the most putative sites within the sex-biased expressed genes (Fig 5C) of which sja-let-7, sja-miR-1 sja-miR-7-5p are male-biased miRNAs, while sja-miR-71b-5p is female-biased [26]. [score:3]
[1 to 20 of 1 sentences]
13
[+] score: 3
The most highly expressed miRNAs in the parasite, such as sja-miR-71, sja-miR-71b-5p and sja-miR-1 [50], are undetectable in the serum/plasma of animal hosts infected with schistosomes [18, 22]. [score:3]
[1 to 20 of 1 sentences]
14
[+] score: 3
Membranes were incubated with biotin-labeled probes complementary to candidate miRNA sequences (sja-miR-1a, sja-miR-1b, sja-miR-7, sja-miR-71b, sja-miR-71a, sja-miR-87, sja-miR-124, sja-miR-281, sja-miR-2b, sja-miR-2a, sja-miR-307, sja-miR-31, sja-miR-133, sja-miR-310, sja-miR-8, sja-miR-10, sja-miR-36, sja-miR-61, sja-miR-277, sja-miR-219, sja-miR-190, sja-miR-candidate-03). [score:1]
Cluster miR-71b contains three miRNA members, the miR-71b, and two schistosome-specific miRNAs (sja-miR-novel-03 and sja-miR-novel-04). [score:1]
Based on the above criterion, 7 miRNAs were tentatively assigned to two clusters: miR-71a and miR-71b with 347 and 420 bp sequence ranges, respectively. [score:1]
[1 to 20 of 3 sentences]
15
[+] score: 2
Indeed, most recently five miRNAs were found by direct cloning in S. japonicum that are also conserved in S. mansoni [55]: let-7, mir-71, bantam, mir-125, and a single schistosome-specific microRNA. [score:2]
[1 to 20 of 1 sentences]
16
[+] score: 1
Furthermore, the 8 conserved miRNAs were identified as originating from 6 miRNA families, namely miR-124, miR-2 (miR-2b, miR-2e), bantam, miR-10, let-7 and miR-71 (miR-71, miR-71b). [score:1]
[1 to 20 of 1 sentences]
17
[+] score: 1
Besides the miR-2 family, another two miRNAs, miR-71 and miR-71b-5p, were also found from one family, which is located on two different scaffolds named as SJC_S000054 and SJC_S000102. [score:1]
[1 to 20 of 1 sentences]