sort by

193 publications mentioning hsa-mir-378b (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-378b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 248
Western blot was used to detect the expression of the proapoptotic gene Bad and anti-apoptotic/apoptosis-suppressing gene Bcl-2. As shown in Fig. 2d, the expression level of Bad increased by 51% while the expression level of Bcl-2 decreased by 48% when miR-378 was overexpressed in SW480 cells. [score:11]
Overexpression of miR-378 not only inhibits the proliferation of colon cancer cells in vitro by inducing apoptosis, but also inhibits migration and invasion by inhibiting the EMT of colon cancer cells. [score:9]
SDAD1 is a direct target gene of miR-378, and knockdown of SDAD1 suppresses the proliferation, migration and invasion of colon cancer cells. [score:7]
Overexpression of miR-378 significantly inhibited the expression of β-catenin and Ki-67 (Fig. 6). [score:7]
We also found that overexpression of miR-378 significantly inhibited the expression of two important transcription factors, TCF-4 and LEF-1 (Fig. 6). [score:7]
miR-378 inhibits the proliferation, migration and invasion of colon cancer cells by targeting SDAD1, defining miR-378 as a potential target for the diagnosis and treatment of colon cancer. [score:7]
miR-378 targets the 3’UTR of SDAD1 to negatively regulate its expression. [score:6]
In SW480 and HCT-116, miR-378 was artificially overexpressed or suppressed. [score:5]
In addition, we found that miR-378 suppresses the malignant behavior of colon cancer cells by inhibiting Wnt/β-catenin pathway. [score:5]
Furthermore, we found that miR-378 inhibits the migration and invasion of colon cancer cells by inhibiting the epithelial–mesenchymal transition (EMT) pathway, and we further investigated the mechanism of miR-378’s tumor suppressor role in colon cancer cells. [score:5]
As shown in Fig. 2a, overexpression of miR-378 significantly inhibited the proliferation of colon cancer cells, and blocking miR-378 could promote the proliferation of colon cancer cells. [score:5]
We determined the expression levels of β-catenin, GSK-3β, p-GSK-3β and Ki-67 in the Wnt/β-catenin pathway in SW480 cells when miR-378 was expressed differently. [score:5]
The results indicated that overexpression of miR-378 could inhibit the EMT process of colon cancer cells (Fig. 3c and d). [score:5]
As shown in Fig. 3a, overexpression of miR-378 in colon cancer cell lines SW480 and HCT-116 inhibited cell migration significantly (by approximately 25%). [score:5]
Overexpression of miR-378 inhibited cell invasion (Fig. 3b). [score:5]
These results indicate that miR-378 suppresses expression of SDAD1 in colon cancer cells. [score:5]
Bioinformatics methods were used to predict the potential targets of miR-378, and luciferase reporter assays were performed to conform the direct binding between miR-378 and its target mRNA. [score:5]
We also found the expression levels of mRNA and protein in SDAD1 respectively decreased by 49% and 50% when miR-378 was overexpressed, while the mRNA and protein levels of SDAD1 respectively increased 4 and 1.5 times when blocking miR-378 (Fig. 4c and d). [score:5]
c FACS was performed to determine the level of cell apoptosis when miR-378 was overexpressed or knocked down. [score:4]
SDAD1 is a direct target gene for miR-378. [score:4]
Western blot was used to measure the levels of β-catenin, Ki-67, GSK-3β, p-GSK-3β, and the transcription factors TCF-4 and LEF-1 when miR-378 was overexpressed A tumor is essentially a polygenic disorder where cells escape the normal growth control mechanism, undergoing autonomic proliferation, becoming invasive, and showing a malignant phenotype due to the activation of one or more proto-oncogenes, or the mutation or deletion of a tumor suppressor gene [10]. [score:4]
Compared to the expression level in the normal colonic epithelial cell line NCM460, miR-378 has a low level of expression in multiple colon cancer cell lines, including LoVo, CaCo2, SW1116, SW480 and HCT-116 (Fig. 1b). [score:4]
Next, the colony formation assay also showed that overexpression of miR-378 inhibited the proliferation capacity by about 25% (Fig. 2b). [score:4]
Fig. 4SDAD1 is a direct target of miR-378. [score:4]
In our study, we found that miR-378 inhibited the Wnt/β-catenin pathway in colon cancer, which may reduce the malignant progression of colon cancer. [score:3]
As shown in Fig. 1a, miR-378 has a low level of expression in colon cancer tissues. [score:3]
We also confirmed that miR-378 can inhibit the proliferation of colon cancer cells. [score:3]
b Quantitative RT-PCR was performed to detect the expression of miR-378 in 5 CRC cell lines (LoVo, CaCo2, SW1116, SW480, HCT-116) and a normal colonic cell line (NCM460). [score:3]
We found that miR-378 expression was low in colon cancer tissues and cell lines. [score:3]
As shown in Fig. 2c, overexpression of miR-378 significantly increased apoptosis in colon cancer cell line SW480, whereas the level of apoptosis decreased when miR-378 was blocked. [score:3]
miR-378 induced Wnt/β-catenin pathway inhibition. [score:3]
By co-transfecting miR-378 with the SDAD1–3’UTR reporter vector into colon cancer cells, we detected the activity of luciferase to demonstrate the condition of miR-378 targeting SDAD1. [score:3]
Overexpression of miR-378 resulted in decreased fluorescence activity and no significant changes in fluorescence activity were observed in mutant UTR (Fig. 4b). [score:3]
miR-378 also inhibits the invasion and migration of colon cancer cells by reducing EMT process. [score:3]
Western blot was used to measure the levels of β-catenin, Ki-67, GSK-3β, p-GSK-3β, and the transcription factors TCF-4 and LEF-1 when miR-378 was overexpressed To determine the miR-378 level in colon cancer, we first determined the expression levels of miR-378 in 27 pairs of colon cancer tissues and adjacent normal tissues using quantitative RT-PCR. [score:3]
These results indicate that miR-378 can inhibit the proliferation of colon cancer cells. [score:3]
In our study, we used bioinformatics algorithms to predict that SDAD1 is a candidate target for miR-378. [score:3]
Next, we detected the expression level of miR-378 in colon cancer cell lines. [score:3]
miR-378 inhibits colon cancer cell migration and invasion. [score:3]
To determine the miR-378 level in colon cancer, we first determined the expression levels of miR-378 in 27 pairs of colon cancer tissues and adjacent normal tissues using quantitative RT-PCR. [score:3]
We believe that miR-378 caused Wnt/β-catenin pathway inhibition. [score:3]
This demonstrates that miR-378 and SDAD1 have a direct and negative regulatory relationship. [score:3]
miR-378 inhibits the growth and proliferation of tumor cells in hepatocellular carcinoma [19]. [score:3]
miR-378 inhibits proliferation of colon cancer cells by inducing apoptosis. [score:3]
miR-378 is expressed at a low level in colon cancer. [score:3]
It was also found that miR-378 inhibited the proliferation of colon cancer cells by inducing apoptosis. [score:3]
In this study, we found that the expression of miR-378 was significantly decreased in colon cancer specimens and cell lines. [score:3]
3’UTR 3′ untranslated region cDNA Complementary DNA CRC Colorectal cancer EMT Epithelial-mesenchymal transition miR-378 microRNA-378 miRNA microRNA MTT 3-(4,5-cimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide Not applicable. [score:3]
This suggests that miR-378 may be a target for the treatment of colon cancer. [score:3]
We also confirmed that miR-378 alleviated the malignant phenotypes of colon cancer cells by inhibiting the Wnt/β-catenin pathway. [score:3]
We believe that miR-378 inhibits the proliferation of colon cancer cells by inducing apoptosis. [score:3]
These data suggest that miR-378 may be a target for colon cancer diagnostics and treatment. [score:3]
This study provides new evidence that miR-378 can inhibit the proliferation of colon cancer cells by promoting apoptosis. [score:3]
In this study, we found that miR-378 plays a tumor suppressor role in colon cancer cells. [score:3]
Conversely, knockdown of miR-378 promoted migration and invasion of colon cancer cells. [score:2]
a Expression of miR-378 in 27 CRC samples was compared with that in adjacent non-tumor tissues; determination via quantitative RT-PCR. [score:2]
However, there are few studies on the relationship between miR-378 and the development of colon cancer. [score:2]
Studies have demonstrated that miR-378 has biological functions that can regulate a variety of tumor cells, including cell proliferation [24], migration and invasion [25], and drug resistance [26]. [score:2]
Our study focuses on the role of miR-378 in colon cancer cells. [score:1]
Cells were transfected with miR-378 mimics or ASO-miR-378 (GenePharma) using Lipofectamine 2000 (Invitrogen) according to the manufacturers’ instructions, then transfected with SDAD1 siRNA (si-SDAD1, GenePharma). [score:1]
The sequence of precursor and mature hsa-miR-378 is available in miRBase (http://www. [score:1]
a The complementary sequences of the miR-378 binding site in SDAD1 3’UTR. [score:1]
To demonstrate that, we constructed the fluorescent reporter vectors with the miR-378 binding site on SDAD1–3’UTR. [score:1]
Therefore, we continued to investigate whether miR-378 in colon cancer cells inhibits Wnt pathway activation. [score:1]
Fig. 2Influences of miR-378 on the proliferation of colon cancer cells. [score:1]
miR-378 Colon cancer Proliferation Migration Invasion SDAD1 Wnt/β-catenin In the worldwide rankings of cancer incidence and mortality, colon cancer ranks third and fourth, respectively [1]. [score:1]
c, d The mRNA (C) and protein (D) levels of SDAD1 were detected using quantitative RT-PCR and western blot, respectively, in SW480 cells transfected with miR-378 mimics. [score:1]
miR-378 has been reported to play an important role in many types of cancer. [score:1]
After 24 h, SW480 cells were co -transfected with 200 ng miR-378 and 50 ng SDAD1–3’UTR plasmids. [score:1]
d Western blot was used to detect the apoptosis proteins Bad and Bcl-2 in SW480 cells transfected with miR-378 mimics. [score:1]
In gliomas, decreased miR-378 levels indicate high tumor invasiveness and poor prognosis [18]. [score:1]
Fig. 3The effect of miR-378 on the migration and invasion abilities of colon cancer cells. [score:1]
Fig. 6 The effect of miR-378 on the Wnt/β-catenin pathway. [score:1]
a, b The effect of miR-378 mimics on the migration (a) and invasion (b) of SW480 and HCT-116 cells determined using Transwell plates. [score:1]
Quantitative RT-PCR was used to detect the miR-378 level in the clinical tissues and cell lines. [score:1]
[1 to 20 of 75 sentences]
2
[+] score: 210
Upregulation of miR-378 in A549/cDDP cells significantly down-regulates sCLU expression, and enhances the sensitivity of A549/cDDP cells to cDDP. [score:9]
In conclusion, we report altered expression of miR-378 in human lung adenocarcinoma cell lines with varying sensitivities to cDDP, and have shown that miR-378 can restore cDDP chemosensitivity in the human lung adenocarcinoma cells by targeting sCLU and downregulating Bcl-2, pCas-3, pErk1/2 and pAkt (Fig. 7). [score:8]
The upper panel showed the growth curves, and the lower panel showed the representative picture of tumors with miR-378 overexpression (right) and Mock (left); (B) showed miR-378 inhibited sCLU expression. [score:7]
showed that either downregulation of sCLU or overexpression of miR-378 increased cell apoptosis in A549/cDDP cells and Anip973/cDDP. [score:6]
It has been shown previously that selective regulation of microRNA activity can improve responsiveness to chemotherapy 20. miR-378 expression is found in a number of cancer cell lines 21 22, and is related to the expression of vascular endothelial growth factor 23 24. [score:6]
Fei et al. reported that miR-378 suppress HBV-related hepatocellular carcinoma tumor growth by directly targeting the insulin-like growth factor 1 receptor 26. [score:6]
In addition, overexpression of miR-378 in A549 cells or Anip973 (both with low CLU expression 8) also had no effect on the sensitivity of the cells. [score:5]
Furthermore, overexpression of miR-378 can reduce the sCLU level (Fig. 3A), sensitize A549/cDDP and Anip973/cDDP cells to cDDP (Fig. 2A, supplement Figures 1B and 4A), and inhibit the tumor growth in nude mice mo del (Fig. 5A). [score:5]
Forced expression of sCLU eliminated most of the gains in the sensitivity to cDDP in miR-378 -overexpressing cells (Fig. 4A), and reversed the decrease of Bcl-2, pCas-3, pErk1/2 and pAkt (Fig. 4B). [score:5]
Taken together, these results suggest that miR-378 suppresses sCLU gene expression through the 3′-UTR binding and silencing of sCLU mRNA. [score:5]
miR-378 inhibited tumor growth and sCLU expression in Nude mouse tumor xenograft mo del. [score:5]
Wang et al. found that miR-378 inhibited cell growth and enhanced L-OHP -induced apoptosis in human colorectal cancer by targeting CDC40 25. [score:5]
miR-378 inhibited tumor growth and sCLU expression in a nude mouse tumor xenograft mo del. [score:5]
In this study, we identified sCLU as a novel target of miR-378; we demonstrated that miR-378 overexpression could decrease sCLU, enhance cell apoptosis, and sensitize lung adenocarcinoma to cDDP both in vitro and in vivo. [score:5]
We found that miR-378 is partially complementary to the 3′ untranslated region (UTR) of the CLU mRNAs using Bioinformatics (TargetScan) (Fig. 1A), and miR-378 can affect the luciferase activity due to canonical binding to sCLU 3′-UTR (Fig. 1B). [score:5]
demonstrated that sCLU was significantly down-regulated in the A549/cDDP-miR-378 cells (P < 0.05) (Fig. 5B). [score:4]
The result showed that upregulation of miR-378 led to a significant decrease of sCLU protein in A549/cDDP cells (Fig. 3A). [score:4]
miR-378 directly targets sCLU. [score:4]
miR-378 targets sCLU and regulated its cell signal. [score:4]
Collectively, these data strongly suggest that miR-378 regulate chemo-resistance to cDDP by targeting sCLU. [score:4]
miR-378 directly Targets sCLU. [score:4]
The results showed that upregulation of miR-378 led to a significantly increased sensitivity to cDDP in A549/cDDP cells (Fig. 3B). [score:4]
The results showed that up-regulation of miR-378 significantly decreased the relative luciferase activity of wild type but had no effect on the mutant 3′UTR of sCLU (Fig. 1B). [score:4]
Similar results also could be seen in Anip973/cDDP, another cell line with high CLU expression 8. After sCLU knockdown, miR-378 transfection had no effect on the sensitivity of the cells (Supplementary Figure 1B). [score:4]
The results showed that overexpression of miR-378, or knockdown of sCLU, both sensitized the cells to cDDP (Fig. 2A). [score:4]
As two sets of observations showed that miR-378 is important in chemoresistance to cDDP 15 16, and as we found that miR-378 was identified as one of the miRNA that target sCLU, we focused our research on miR-378. [score:3]
The tumor growth curve analysis showed that miR-378 significantly inhibited the tumor growth in 18 days after the injection of cells (p < 0.05) (Fig. 5A). [score:3]
sCLU is involved in miR-378 -induced cisplatin resistance in vitroTo test whether sCLU is a target of miR-378, was used to check the effect of miR-378 transfection on sCLU in the A549/cDDP cell line. [score:3]
Interestingly, previous studies have indicated that miR-378 transfection enhanced cell survival, tumor growth, and angiogenesis in NSCLC cells, but target genes were not identified 23 24. [score:3]
Correlation analysis showed that miR-378 was negatively correlated with sCLU expression level (r = −0.538). [score:3]
As shown in Fig. 1A, the sequence of miR-378 was partially complementary to the 3′ untranslated region (UTR) of the sCLU mRNAs (7 nucleotides completely match). [score:3]
Moreover, our data are also corroborated by the observations in human tumor tissues obtained from patients who showed sensitivity or insensitivity to cDDP, and we found an inverse correlation between miR-378 and sCLU expression levels in tumor tissues samples. [score:3]
C. Correlation analysis shows that miR-378 negatively correlates with the sCLU mRNA expression level, r = −0.538. [score:3]
org) to search the miRNAs that may target sCLU, which revealed many candidates (including miR-378). [score:3]
This data is corroborated by the expression of miR-378 and sCLU in A549 vs A549/cDDP (Fig. 1C,D) and Anip973 vs Anip973/cDDP 8 (supplementary Figure 1A). [score:3]
Therefore, targeting this miR-378-sCLU interaction may be a potential strategy for reversing cDDP chemoresistance in human lung adenocarcinoma. [score:3]
Based on the patients’ response to chemotherapy, they were divided into “sensitive” and “insensitive” groups, and the miR-378 levels and sCLU expression levels of each sample were analyzed. [score:3]
miR-378 transfection sensitized these cells to cDDP only after sCLU overexpression (supplementary Figure 2). [score:3]
With this in mind, the effect of miR-378 was determined by the function of target genes in the current study. [score:3]
To test whether sCLU is a target of miR-378, was used to check the effect of miR-378 transfection on sCLU in the A549/cDDP cell line. [score:3]
How to cite this article: Chen, X. et al. miRNA-378 reverses chemoresistance to cisplatin in lung adenocarcinoma cells by targeting secreted clusterin. [score:3]
To investigate how miR-378 overexpression affected sCLU expression and tumor growth, agomir-378 cells and cells with agomir-NC(Mock) were injected into the flank of nude mice. [score:3]
A mechanistic mo del of regulation of lung adenocarcinoma’s sensitivity to cDDP via miR-378 and sCLU. [score:2]
To our knowledge, our study is the first to demonstrate the association of miR-378 with the development of cDDP chemoresistance in human lung adenocarcinoma. [score:2]
Next, we compared the expression of miR-378 and sCLU in the cisplatin-resistant A549 cell line (A549/cDDP) with its parental A549 cell line. [score:2]
The expression level of miR-378 was detected with gene-specific primers as described 38. [score:2]
On the contrary, after sCLU knockdown, transfection of miR-378 did not change the apoptotic rate (Fig. 2B,C, and supplementary Figure 3). [score:2]
To verify that miR-378 targets sCLU, we cloned a fragment of CLU 3′UTR containing the putative miR-378 binding site, or its mutated one, into a luciferase reporter vector, and performed dual luciferase assays in 293T cells. [score:2]
We found that miR-378 expression level was significantly lower in the “insensitive” group tissues (0.40 ± 0.02) compared to the “sensitive” group (0.51 ± 0.03) (P < 0.05) (Fig. 6A). [score:2]
We transfected A549/cDDP cells with the miR-378 mimics(miR-378), and performed. [score:1]
sCLU is involved in miR-378 -induced cisplatin resistance in vitro. [score:1]
These results showed that miR-378’s effect on the sensitivity of the cells to cDDP or apoptosis depended on the presence of higher levels of sCLU, so it strongly indicated that miR-378 affected sensitivity of the cell and apoptosis through sCLU. [score:1]
miR-378 and sCLU affects A549/cDDP cell’s sensitivity to cDDP and apoptosis in cells. [score:1]
miR-378 increases sensitivity of A549/cDDP to cDDP and apoptosis through sCLU. [score:1]
Thus, we clearly established an inverse relationship between miR-378 and sCLU. [score:1]
The lower panel is the miR-378 sequence containing the putative sCLU binding site and its mutant sequence. [score:1]
After 8 days, Agomir-miR-378 or agomir-NC (RiboBio Co. [score:1]
To investigate the association between miR-378 and sCLU expression, 33 tumor tissue samples were obtained from patients with advanced lung adenocarcinoma. [score:1]
sCLU is involved in miR-378 -induced cisplatin resistance. [score:1]
We went further to test miR-378’s effect on apoptosis. [score:1]
To test miR-378’s effect on A549/cDDP’s sensitivity to cDDP, was performed. [score:1]
miR-378 and sCLU correlated with sensitivity to cDDP in lung adenocarcinoma tissues. [score:1]
miR-378 and sCLU are correlated with sensitivity to cDDP in lung adenocarcinoma tissues. [score:1]
To further examine whether sCLU is involved in miR-378 induced chemoresistance, we performed gain-of-function and loss-of-function analysis. [score:1]
Also, miR-378 is shown to be important in chemoresistance to cDDP, but no detailed mechanism is reported 15 16. [score:1]
miR-378 mimics, sCLU siRNA, sCLU(plasmid) or their controls were purchased from Sigma. [score:1]
HEK293T cells were seeded in a 24-well plate and transfected with 20 μM of either miR-378 mimics or miR-NC vectors, and 50 ng of psicheck-2 vectors. [score:1]
[1 to 20 of 67 sentences]
3
[+] score: 205
Since overexpression of miR-378-5p suppressed proliferation and induced apoptosis of CRC cells, and given that BRAF is a direct target of miR-378-5p, we hypothesized that the inhibitory effect of miR-378-5p on CRC cell viability might be achieved via targeting BRAF. [score:12]
miR-378-5p can inhibit proliferation of CRC cells and induce CRC cells apoptosis by directly suppressing the expression of BRAF. [score:8]
miR-378-5p is reported dysregulated expressed in several malignancies and the function of miR-378-5p is complicated because it can be oncogenic in glioblastoma, breast cancer and non-small cell lung cancer [9- 11] or a tumor suppressor in liver cancer, gastric cancer and oral cancer [12- 14]. [score:6]
This result indicates that miR-378-5p can bind directly to BRAF and inhibits the expression of BRAF. [score:6]
In the present study, we identify that miR-378-5p is down-regulated in CRC and can suppress cell proliferation and induce apoptosis in CRC cells. [score:6]
Knowing BRAF was the target of miR-378-5p, we tested the expression of BRAF in the 47 CRC and adjacent non-tumor tissues. [score:5]
miR-378-5p was found to be an independent prognostic factor and could inhibit cell growth and invasion in CRC by targeting vimentin [32]. [score:5]
These results demonstrate that overexpression of miR-378-5p inhibits growth of CRC cells by blocking G1/S transition. [score:5]
In this study, BRAF was identified to be directly targeted and regulated by miR-378-5p in CRC cells. [score:5]
These findings suggest that miR-378-5p suppresses CRC cells growth and induces apoptosis, at least in part, by targeting BRAF. [score:5]
The expression level of miR-378-5p was decreased in CRC cell lines (Figure  1B) and transfection of miR-378-5p mimics restored its expression level in both SW480 and HCT-116 CRC cells (Figure  2A). [score:5]
We prove the potential tumor suppressor role of miR-378-5p involved in CRC by identifying one new targeting gene BRAF. [score:5]
The results indicated that the expression level of BRAF mRNA was greatly increased in CRC comparing to adjacent non-tumor tissues (42/47, 89.4%, p <0.001) (Figure  4E) and was inversely related to the expression of miR-378-5p (Figure  4F). [score:5]
The decreased expression of miR-378-5p in CRC tissues inspired us to assume miR-378-5p to be a tumor suppressor. [score:5]
miR-378-5p inhibits the proliferation and induces apoptosis of CRC cells via regulation of RAS/RAF/MEK/ERK pathway. [score:4]
Our results demonstrated that BRAF was another direct target gene of miR-378-5p in CRC cells. [score:4]
As shown in Figure  4C and D, The level of BRAF mRNA and protein was consistently and substantially down-regulated by miR-378-5p. [score:4]
Overexpression of miR-378-5p in CRC cells significantly decreased the proliferation and induced apoptosis by regulating RAS/RAF/MEK/ERK pathway. [score:4]
In this study, we demonstrated that miR-378-5p is dramaticly down-regulated in CRC cell lines. [score:4]
However, the mechanism of miRNA-378-5p in CRC development is not very clear for poor targeting information. [score:4]
In addition, we identified BRAF as a new direct and functional target of miR-378-5p in CRC cells. [score:4]
Several studies have reported that miR-378-5p was significantly down-regulated in CRC [15- 18]. [score:4]
miR-378-5p directly targets BRAF in CRC cells. [score:4]
Our results showed that miR-378-5p was down-regulated in CRC tissues and cell lines which agreed with the previous studies [15- 18]. [score:4]
The results showed that protein levels of BRAF, p-ERK, c-Myc and Bcl-2 were consistently down-regulated by both miR-378-5p mimics and BRAF siRNA (Figure  5A). [score:4]
In addition, Overexpression of miR-378-5p in CRC cells significantly decreased the proliferation and induced apoptosis by regulating RAS/RAF/MEK/ERK pathway. [score:4]
Expression of miR-378-5p is greatly decreased in CRC. [score:3]
We cloned the potential targeting sequence of miR-378-5p into a luciferase reporter vector. [score:3]
This was further confirmed by testing the relative expression level of miR-378-5p in 47 CRC tissues and corresponding adjacent non-tumor tissues using qRT-PCR. [score:3]
The CLASH data have showed that 103 genes were targeted by miR-378-5p. [score:3]
Colorectal cancer miR-378-5p BRAF Proliferation Apoptosis Colorectal cancer possesses the third highest incidence of human malignant diseases that account for approximately 9.4% of worldwide cancer cases. [score:3]
These observations suggest that miR-378-5p may be a tumor suppressor in CRC. [score:3]
However, the role of miR-378-5p in CRC is not well known for the limitation of target gene information. [score:3]
In this study, we studied the expression profile of miR-378-5p in CRC. [score:3]
We then detected whether cell cycle arrest contributed to the growth inhibition of miR-378-5p transfected cells. [score:3]
In order to confirm the involvement of miR-378-5p in CRC, we tested the relative expression level of miR-378-5p in 47 CRC tissues and corresponding adjacent non-tumor tissues using qRT-PCR. [score:3]
miR-378-5p inhibits proliferation of CRC cells in vitro. [score:3]
As shown in Figure  2B, proliferation of CRC cells was suppressed following transfection with miR-378-5p at 48 hours (19.5%, p <0.05), 72 hours (24.6%, p <0.05) and 96 hours (29.8%, p <0.01) in SW480 cells and 48 hours (16.8%, p <0.05), 72 hours (26.1%, p <0.05) and 96 hours (28.1%, p <0.01) in HCT-116 cells. [score:3]
In conclusion, our study demonstrates that the expression of miR-378-5p is decreased in CRC. [score:3]
Overexpression of miR-378-5p in CRC cells decreased both mRNA and protein level of BRAF in CRC cells. [score:3]
Taken together, the results indicate that miR-378-5p inhibits the proliferation of CRC cells in vitro. [score:3]
Interestingly, the function of miR-378-5p is complicated because it can be oncogenic in glioblastoma, breast cancer and renal cell carcinoma [9, 10, 33] or a tumor suppressor in liver cancer, colorectal cancer, gastric cancer and oral cancer [12, 13, 31]. [score:3]
It was also shown that miR-378-5p was down-regulated in 5 CRC cell lines, compared with 5 normal colorectal tissues (Figure  1B). [score:3]
Furthermore, we show that miR-378-5p suppress cell proliferation and induce apoptosis in CRC cells through RAS/RAF/MEK/ERK pathway. [score:3]
As shown in Figure  4B, transfection of miR-378-5p caused a significant decrease in luciferase activity in cells transfected with the reporter plasmid with wild-type targeting sequence of BRAF mRNA but not reporter plasmid with mutant sequence. [score:3]
This points to a proapoptotic role of miR-378-5p and suggests that miR-378-5p affects apoptotic pathways in regulating tumorigenicity. [score:2]
HEK 293 T cells were placed onto 24-well plate and co -transfected with pMIR-BRAF-WT mRNA reporter plasmids (100 ng) or pMIR-BRAF-Mut mRNA reporter plasmids (100 ng), pMIR-TK (25 ng) and miR-378-5p mimics or negative control oligonucleotides (50 nM) using jetPEI (Polyplus). [score:1]
miR-378-5p induces apoptosis of CRC cells in vitro. [score:1]
The mRNA and protein level of BRAF in SW480 and HCT-116 cells was also analyzed after transfection of miR-378-5p. [score:1]
This was consistent with that miR-378-5p was decreased in CRC and gastric cancer [12, 31]. [score:1]
Similar effects of miR-378-5p were found in HCT-116 cells, with 59.6% of miR-378-5p transfected cells in G0/G1 versus 47.2% of control cells (Figure  2C). [score:1]
This may owe to the differences of the tumor microenvironment, including the external stimula, the inflammational environment or the stroma cells, which lead miR-378-5p to exhibit opposite effects, but the mechanism needs further study. [score:1]
All of the above indicate that miR-378-5p is served as an anti-oncogene in CRC. [score:1]
Why miR-378-5p functions so differently in different kinds of tumors? [score:1]
Our results also showed that miR-378-5p was negatively correlated with BRAF mRNA in CRC tissues. [score:1]
miR-378-5p mimics induced CRC cells apoptosis in SW480 (A) and HCT-116 (B). [score:1]
From the CLASH data in HEK 293 cells, the potential targeting sequence for miR-378-5p with a calculated energy of −17.1 kcal/mol is within the protein coding region of BRAF mRNA from 1321 to 1367. [score:1]
The result showed that the cell cycle was arrested in G1 phase, with 68.9% of miR-378-5p transfected cells in G0/G1 versus 49.4% of control cells in SW480 cells. [score:1]
SW480 and HCT-116 cells were transfected with miR-378-5p or BRAF siRNA, and protein levels of RAS/RAF/MEK/ERK pathway were examined b ywestern blot. [score:1]
Our data may suggest a new perspective on how miR-378-5p involved in colon cancer. [score:1]
SW480 and HCT-116 cells were transfected with miR-378-5p mimics or negative control oligonucleotides using INTERFERin (Polyplus). [score:1]
[1 to 20 of 61 sentences]
4
[+] score: 186
In addition, protein expression of caspase-3 is significantly downregulated by miR-378 overexpression in the OGD -treated N2A cells. [score:8]
Overexpression of miR-378 could protect the neural cells against OGD or MCAO induced ischemic injury by targeting the apoptosis executioner caspase-3. In accordance with the changes of miR-378 in the peri-infarct region of MCAO mice [15], we examined the miR-378 expression in N2A cells during reoxygenation after 3 h OGD exposure. [score:7]
To further analyze the contribution of miR-378 targeting caspase-3 to the biological function of miR-378 in OGD -induced N2A cell injury, we performed siRNA -mediated inhibition of caspase-3 protein expression. [score:7]
Ma T. Jiang H. Gao Y. Zhao Y. Dai L. Xiong Q. Xu Y. Zhao Z. Zhang J. Microarray analysis of differentially expressed microRNAs in non-regressed and regressed bovine corpus luteum tissue; microRNA-378 may suppress luteal cell apoptosis by targeting the interferon γ receptor 1 gene J. Appl. [score:7]
Extensive evidence showed that miR-378 attenuated ischemic injury in cardiomyocytes by inhibiting caspase-3 expression, representing a potential novel treatment for apoptosis and ischemic heart disease [16]. [score:7]
Fang J. Song X. W. Tian J. Chen H. Y. Li D. F. Wang J. F. Ren A. J. Yuan W. J. Lin L. Overexpression of microRNA-378 attenuates ischemia -induced apoptosis by inhibiting caspase-3 expression in cardiac myocytes Apoptosis Int. [score:7]
Among the aberrantly expressed miRNAs, the downregulation of miR-378 in the peri-infarct region of middle cerebral artery occluded (MCAO) mice can be reversed by HPC pretreatment. [score:6]
As described by the previous report, miR-378 could inhibit caspase-3 protein expression and attenuated ischemic injury in cardiomyocytes [16]. [score:5]
Overexpression of miR-378 substantially suppressed the OGD -induced N2A cell death, whereas transfection of anti-miR-378 aggravated the cell death. [score:5]
In addition, pri-miR-378 effectively decreased the expression of caspase-3, whereas anti-miR-378 increased the expression of caspase-3 in mouse N2A cells exposed to 3 h OGD/24 h reoxygenation (Figure 3C,D, p < 0.05, n = 3 per group). [score:5]
In the present study, we used TargetScan to identify caspase-3 as the target gene of miR-378. [score:5]
Taken together, these results suggest that miR-378 directly regulated caspase-3 expression, which might be involved in the neuroprotection of miR-378. [score:5]
These data indicated that miR-378 directly regulated caspase-3 expression by binding to the 3′-UTR of Caspase-3 mRNA. [score:5]
Overexpression of miR-378 substantially suppressed the cell death, whereas transfection of anti-miR-378 aggravated the N2A cell death induced by 3 h OGD/24 h reoxygenation (Figure 1C–F, p < 0.05, n = 6 per group). [score:5]
In bovine corpus luteum tissue, miR-378 may suppress luteal cell apoptosis by targeting the interferon gamma receptor 1 gene [29]. [score:5]
Effect of miR-378 on the mRNA and Protein Expression Levels of Its Target Gene Caspase-3. 2.3. [score:5]
Western blot analysis showed that miR-378 agomir but not its negative control could downregulate caspase-3 protein level and cleaved-caspase-3 ratio in cerebral ischemic cortex of mice after 1 h MCAO/24 h reperfusion (Figure 4A–C p < 0.05, n = 4 per group). [score:4]
In the present study, we found that miR-378 was downregulated during reoxygenation in OGD -induced N2A cell ischemic mo del, which is consistent with the changes in the peri-infarct region of MCAO mice found by large-scale microarray screening in our previous report. [score:4]
Moreover, the luciferase reporter gene assay indicated that miR-378 targeted the 3′-UTR region of caspase-3 to decrease the protein level of the target gene. [score:4]
Lee D. Y. Deng Z. Wang C. H. Yang B. B. MicroRNA-378 promotes cell survival, tumor growth, and angiogenesis by targeting sufu and FUS-1 expression Proc. [score:4]
In conclusion, we reported for the first time that the protective role of miR-378 in N2A cells after OGD in vitro and mouse brain following the MCAO -induced ischemic stroke in vivo through downregulating caspase-3 protein levels. [score:4]
We found that, among the significantly changed miRNAs, the reduced expression of miR-378 in the peri-infarct region of MCAO mice could be reversed by HPC pretreatment, indicating that miR-378 might be a key molecule in the development of neuroprotection. [score:4]
We found that the expression of miR-378 significantly decreased upon OGD treatment. [score:3]
However, other possible targets of miR-378 and the upstream regulation of miR-378 by transcriptional factors must also be investigated to fully understand the neuroprotective effect of miR-378 in the development of ischemic stroke. [score:3]
In accordance with the changes of miR-378 in the peri-infarct region of MCAO mice [15], we examined the miR-378 expression in N2A cells during reoxygenation after 3 h OGD exposure. [score:3]
To examine whether caspase-3 is responsible for OGD -induced N2A cell apoptosis, we analyzed the possibility of caspase-3 being a putative target of miR-378 by bioinformatics algorithms. [score:3]
This research points out a novel mechanism for the miR-378 induced neuroprotection by targeting caspase-3, which may become a potential therapeutic option for ischemic stroke. [score:3]
Experimentally, the expression of caspase-3 gradually increased at different reoxygenation times after OGD treatment, which is converse with the changes of miR-378 level. [score:3]
Then we examined the effect of miR-378 overexpression on MCAO -induced infarction and neural cell loss by TTC and Nissl staining, respectively. [score:3]
Huang Y. Liu X. Wang Y. MicroRNA-378 regulates neural stem cell proliferation and differentiation in vitro by modulating tailless expression Biochem. [score:3]
It is shown that expression of miR-378 can enhance cell survival, reduce caspase-3 activity, and promote tumor growth and angiogenesis [28]. [score:3]
Effect of miR-378 Overexpression on Transient Focal Cerebral Ischemic Injury of Mice. [score:3]
The results showed that miR-378 expression level decreased gradually and reached the platform at 24 h reoxygenation compared with the normoxic control (Figure 1A, p < 0.05, n = 5 per group). [score:2]
Most importantly, we found that miR-378 could induce neuroprotection through negatively regulating caspase-3 associated apoptosis. [score:2]
Caspase-3 Knockdown Blocked Anti-miR-378-Mediated Neuronal Injury in N2A Cells. [score:2]
To verify whether miR-378 can directly bind the 3′-UTR of Caspase-3 mRNA, we cloned a luciferase reporter encoding Caspase-3 3′-UTR, which contains the putative miR-378 binding sequences. [score:2]
In addition, caspase-3 knockdown could reverse anti-miR-378 mediated neural injury. [score:2]
Nagalingam R. S. Sundaresan N. R. Noor M. Gupta M. P. Solaro R. J. Gupta M. Deficiency of cardiomyocyte-specific microRNA-378 contributes to the development of cardiac fibrosis involving a transforming growth factor β (TGFΒ1) -dependent paracrine mechanism J. Biol. [score:2]
To further evaluate the biological role of miR-378 in cerebral ischemic injury in vivo, we employed a micro infusion pump to continuously deliver miR-378 agomir into the lateral ventricle to increase miR-378 expression. [score:1]
We found that there were potential binding sites between mmu-miR-378 and the 3′-UTR of Caspase-3 mRNA. [score:1]
Consequently, miR-378 agomir effectively attenuated infarction size (Figure 4D) and neuronal cell loss (Figure 4E–G, p < 0.05, n = 4 per group) in ischemic brain of MCAO mice. [score:1]
MTT results showed that caspase-3 siRNA had the ability to block anti-miR-378 -mediated neuronal injury induced by OGD treatment (Figure 5C, p < 0.05, n = 6 per group). [score:1]
The intracerebroventricular infusion of miR-378 agomir and its negative control was performed two days before MCAO as described [32, 33]. [score:1]
Recently, the potential role of miR-378 in cardiac remo deling [26], neural stem cell proliferation [27], and the progression of various carcinoma had been discovered. [score:1]
To determine the role of miR-378 in OGD -induced cell injury, we used pri-miR-378 and anti-miR-378 to alter miR-378 levels in cultured N2A cells. [score:1]
The following day, cells were co -transfected with 100 ng pmiR-RB-REPORT™ vector, including the 3′-UTR of Caspase-3 (with either wild-type or mutant miR-378 binding sites), and 100 ng pri-miR-378 or anti-miR-378 by using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). [score:1]
A 668-bp segment from the 3′-UTR of the Caspase-3 gene containing miR-378 binding sites was amplified by PCR from 3T3 cell genomic DNA, and then cloned into the pmiR-RB-REPORT™ vector (Guangzhou RiboBio Co. [score:1]
Effect of miR-378 on OGD-Induced Ischemic Injury in N2A Cells. [score:1]
We also noticed that miR-378 could attenuate apoptosis examined by TUNEL and cleaved-caspase-3 staining. [score:1]
As shown in Figure 3E, the pri-miR-378 significantly decreased luciferase activity of the reporter vector containing 3′-UTR of Caspase-3 mRNA, but had no effect on the mutated reporter vector (p < 0.05, n = 6 per group). [score:1]
In specific experiments, mouse N2A cells were plated in 96-well or six-well plates and transfected with miR precursor (pri-miR-378), miR-378 antisence (anti-miR-378), and their negative controls (JIKAI, Shanghai, China) at a final concentration of 30 nM, or Caspase-3 and its negative control siRNAs (Gene Pharma, Shanghai, China) at a final concentration of 20 µM by using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. [score:1]
We then co -transfected these luciferase reporter vectors with pri-miR-378, pri-miR-378 ctrl, anti-miR-378, anti-miR-378 ctrl respectively into N2A cells. [score:1]
The results confirmed that transfection of pri-miR-378 attenuated 3 h OGD/24 h reoxygenation induced cell apoptosis, while anti-miR-378 aggravated 3 h OGD/24 h reoxygenation induced cell apoptosis (Figure 2C). [score:1]
However, until now, no evidence was known about the functional significance of miR-378 in cerebral ischemic injuries. [score:1]
Continuous infusion of mouse mmu-miR-378 (13314114400) agomir and its negative control (5 pmol/µL, 1 µL/h, Ribobio, Guangzhou, China) was conducted through a infusion cannula, which was stereotaxically implanted into the left lateral ventricle of the brain (Bregma: −2.2 mm, dorsoventral: 3 mm, lateral: 1 mm). [score:1]
However, pri-miR-378 and anti-miR-378 had no effect on Caspase-3 mRNA levels (Figure 3F, p < 0.05, n = 5 per group). [score:1]
Continuous delivery of the miR-378 agomir effectively attenuated MCAO -induced apoptosis, cerebral infarction, and neural cell loss. [score:1]
The above results indicated that miR-378 can exert neuroprotective effect partially by reducing caspase-3 associated cell apoptosis. [score:1]
This study is designed to further elucidate the role of miR-378 in the N2A cell ischemic mo del in vitro and the mouse focal ischemic stroke mo del in vivo. [score:1]
We also generated a mutant 3′-UTR of the Caspase-3 gene with substitution of 6 bp from seed region of the predicted mmu-miR-378 binding site. [score:1]
The present study showed that miR-378 level significantly decreased in N2A cells after OGD treatment. [score:1]
To our knowledge, this is the first report described the involvement of miR-378 in the in vitro and in vivo cerebral ischemic mo dels. [score:1]
Transfection of pri-miR-378 could significantly attenuate, while anti-miR-378 enhanced the number of TUNEL -positive cells. [score:1]
As shown in Figure 1B, transfection of pri-miR-378 or anti-miR-378, but not their negative controls, significantly increased or decreased miR-378 levels in normoxia and 3 h OGD followed by 24 h reoxygenation (p < 0.05, n = 5 per group). [score:1]
[1 to 20 of 64 sentences]
5
[+] score: 152
overexpression of miR-378 suppressed prostate cancer cell migration and invasion promoted cell apoptosis and stably miR-378 -overexpressed prostate cancer cells displayed a significantly reduction in tumor growth [38]. [score:7]
It was also found that miR-378 expression was suppressed in GBM [9]. [score:5]
Over -expression of miR-378 inhibits glioma cell migration and invasion [9]. [score:5]
Figure 4 by p38 signaling pathway(A): analysis of p-P38, Bax, PCNA expressed in U87-miR-378 and U87-GFP cells with or without curcumin and miR-378 inhibitor treated. [score:5]
Con In: control miRNA-378 inhibitor; In: miRNA-378 inhibitor; Cur:curcumin. [score:5]
Our data revealed that miR-378 acquired tumor inhibition with curcumin through targeting p-p38. [score:5]
Li et al demonstrated that miR-378 functioned as a tumor suppressor and played an important role in inhibiting tumor migration and invasion [9]. [score:5]
Our in vivo study indicated that 60 mg/kg and 120 mg/kg curcumin was sufficient to suppress tumor growth induced by miR-378 expression. [score:5]
Control In: negative miRNA-378 inhibitor; miRNA-378 In: miRNA-378 inhibitor; C: curcumin. [score:5]
Thus, we conclude that miR-378 acts as a potential tumor suppressor in GBM, a function that is accomplished by target p38. [score:5]
In the future, studies on the regulation of miR-378 promoter may help to identify small molecule drugs that may induce the endogenous expression of miR-378. [score:4]
Figure 3Effects of miR-378 inhibitor, curcumin and miR-378 inhibitor on the growth of U87-GFP and U87-miR-378 cells by MTT assay (A) and flow cytometer (B, C). [score:4]
Effects of miR-378 inhibitor, curcumin and miR-378 inhibitor on the growth of U87-GFP and U87-miR-378 cells by MTT assay (A) and flow cytometer (B, C). [score:4]
miR-378 potentiates inhibitory effect of curcumin on GBM growth. [score:3]
Besides, miR-378 also involved in breast cancer, Browne G et al identifies a novel and clinically relevant mechanism for regulation of Runx1 in breast cancer that is mediated by PPARGC1B-miR-378-Runx1 regulatory pathway [37]. [score:3]
U87 cells over expressing miR-378 were used to investigate whether miR-378 could influence the inhibitory effect of curcumin on cell proliferation. [score:3]
miR-378 could counteract the inhibition of p38 by increasing phosphorylation of p38, thereby increasing the sensitivity of cells to curcumin. [score:3]
Interestingly, we found that 50 μM curcumin demonstrated higher inhibition on U87-miR-378 proliferation than on U87-GFP (P<0.05) after 48 h and 72 h treatments (Figure 2B). [score:3]
A total of 2 × 10 [5] cells per well of U87 cells were seeded in 6-well plates and transfected with miR-378 mimic or inhibitor (Ambion, Thermo Scientific, Waltham, MA, USA) following Fast-Forward Transfection protocol (QIAGEN, Hilden, Germany). [score:3]
There was not significant affection in miR-378 level after treated by p38 inhibitor (SB203580) (Figure 4B & 4C). [score:3]
MiR-378 could directly target secreted clusterin and help disable the chemoresistance against cisplantin in lung adenocarcinoma cells [36]. [score:3]
miR-378 enhances the effect of curcumin by suppressing cell proliferation and inducing apoptosis. [score:3]
Patients with lower miR-378 expression levels also have a significantly poorer overall survival [39]. [score:3]
We found that p-p38 was up-regulated in U87-miR-378 cells formed tumor compared to that of U87-GFP cells. [score:3]
There is significantly difference between U87-GFP and U87-miR-378 cells in the curcumin group and miR-378 inhibitor with curcumin group. [score:3]
Abnormal expression of miR-378 has been reported in many cancer cell lines, such as K562, Jurkat, and HL-60 [8]. [score:3]
A miR-378 inhibitor was transfected into the cells to confirm the functions of miR-378 described above. [score:3]
Human glioblastoma U87 cell lines stably expressing miR-378 (U87-miR-378) or green fluorescent protein as control (U87-GFP) were obtained from Dr. [score:3]
We found that miR-378 significantly enhanced the effect of 50 µM curcumin treatment by suppressing the proliferation of U87 cells (Figure 2). [score:3]
All those findings are consistent with the results of our work and strongly support that fact that miR-378 may synergistically act with curcumin in inhibiting the growth of glioblastoma cells. [score:3]
Transfection of U87 with miR-378 inhibitor. [score:3]
According to the results, the growth of U87-miR-378 tumors (Figure 1A & 1C) was significantly inhibited by 60 mg/kg curcumin (611.2 ± 214.6, P<0.01) and 120 mg/kg curcumin (358.8 ± 166.5, P<0.01) when compared with the PVP (Polyvinylpyrrolidione) group (881.32 ± 189.84) after 2 weeks of treatment. [score:2]
MiR-378 potentiates inhibitory effect of curcumin on GBM growth. [score:2]
The results suggested that the inhibitory effect of miR-378/curcumin observed in MTT assay (Figure 2A & 2B) was due to apoptosis but not other factors, such as change of cell cycle duration. [score:2]
In addition, the expression level miR-378 was significantly lower in glioma tissues compared with non-neoplastic brain tissues. [score:2]
To investigate the mechanism underlying the interaction between miR-378 and curcumin, western blot was performed to determine the expression of phosphorylation extracellular signal-regulated kinase (ERK), Akt and P38, as well as neuropilin in mice (Figure 1G). [score:2]
60 mg/kg and 120 mg/kg curcumin could suppress tumor growth formed by U87-miR-378 cells to a greater extent compared with control U87-GFP cells. [score:2]
MiR-378 enhances the effect of curcumin by suppressing cell proliferation and inducing apoptosis. [score:2]
Since miR-378 was reported to be able to regulate Mitogen-Activated Protein Kinase Pathway (MAPK) [18], we next examined whether the MAPK pathway had been affected by the miR-378/curcumin axis. [score:2]
Stable U87-GFP and U87-miR-378 cells were treated with 0 μM, 5 μM, 15 μM, 25 μM and 50 μM curcumin-PVP. [score:1]
The result showed that the survival fraction was significantly different in 15 µM dose and 25 µM doses (U87-GFP vs U87-miR-378 cell), which indicated that the U87-miR-378 cell was more sensitive to curcumin treatment. [score:1]
MiR-378 has emerged as molecular regulators that play key roles in pathogenesis and progression of different maliganceise. [score:1]
Collectively, these data suggested that miR-378 enhanced U87 cell line responses to curcumin treatment via stimulating the P38 signaling pathway. [score:1]
All of the results indicated that the U87-miR-378 cell line was more sensitive to 15 µM and 25 µM curcumin treatment than U87-GFP. [score:1]
Furthermore, the survival rate was not significantly different between the two cells at 5 µM and 10 µM curcumin treatment, but was significantly different at 15 µM (P<0.01, U87-miR-378 VS U87-GFP) (Figure 2E) and 25 µM (P<0.01, U87-miR-378 VS U87-GFP, data not show here). [score:1]
To generating tumor xenografts, 2 million U87-miR-378 or U87-GFP cells were subcutaneously injected into the hind legs of the mice. [score:1]
miR-378 enhances U87 cell line responses to curcumin treatment via stimulating P38 signaling pathway. [score:1]
In this study we examined whether miR-378 may influence the effect of curcumin on GBM and we found that miR-378 enhanced the response of Glioblastoma cells to curcumin treatment. [score:1]
Source tumors were initiated from in vitro cultured cells (U87-miR-378 and U87-GFP cells). [score:1]
miR-378 could enhance the sensitivity of curcumin treatment in U87 cells, which can help us solve the toxicity of high-dose curcumin. [score:1]
This was designed to test whether U87-miR-378 cell were less aggressive than U87-GFP cells. [score:1]
Collectively, our results together with previous reports clearly suggest that miR-378 plus curcumin could be a useful combination for the treatment of GBM. [score:1]
Thus, we infer that the reduction in the growth of U87 may be caused by decreases phosphorylation of p38, which was curbed by miR-378. [score:1]
Both U87-miR-378 and control U87-GFP cells formed obvious tumors at Day 11 post-injection (Figure 1A & 1B). [score:1]
U87-miR-378 or U87-GFP cells were seeded in 96 well plates at 2000/per well and incubated for 24 hours before drug treatment were conducted. [score:1]
Our study mainly focuses on whether miR-378 could enhance U87 cell line response to curcumin therapy. [score:1]
U87-miR-378 and U87-GFP control cells were harvested by trypsinization and washed once with PBS. [score:1]
[1 to 20 of 57 sentences]
6
[+] score: 132
Thus, genome-wide screening of miRNA expression using the more advanced version provided the updated miRNA expression profiles in liver fibrosis and revealed that expression of miR-378 family members including miR-378a-3p, miR-378b and miR-378d were the most significantly reduced among the differentially expressed miRNAs in CCl [4] -induced liver fibrosis, compared with control. [score:8]
Those findings suggest that the expression level of miR-378 also influences the expression of Hh signalling in hepatocytes and LSECs, including HSCs, by regulating Gli3 expression. [score:8]
The expressional changes of precursor and mature form of miR-378b and miR-378d were subtle or rare in Smo inhibitor -treated cells, indicating that Smo poorly influenced their expression. [score:7]
Seven miRNAs (mmu-miR-574-5p, mmu-miR-466i-5p, mmu-miR-342-3p, mmu-let7i-5p, mmu-miR-34a-5p, mmu-miR-188-5p and mmu-miR-5119) were upregulated and the other five (mmu-miR-378a-3p, mmu-miR-202-3p, mmu-miR-378b, mmu-miR-378d and mmu-miR-212-3p) were downregulated in the CCl [4] group compared with the control (Fig. 1a,b). [score:6]
In line with these results, our data showed that members of miR-378 were upregulated in the qHSCs and its' expression in these cells was similar with it in hepatocytes. [score:6]
In addition, miR-378b tended to be downregulated in livers from MCDE-fed mice during liver injury (Fig. 9b). [score:4]
Among these miRNAs that were dysregulated in liver fibrosis, several miR-378 family members, including miR-378a-3p (0.395-fold), miR-378b (0.390-fold) and miR-378d (0.372-fold), had the lowest expression in the livers of CCl [4] -treated mice. [score:4]
Expression of miR-378 was also reduced in Hh-responsive LSECs, compared with both of the qHSCs and the hepatocytes that express lower Hh signalling (Fig. 2). [score:4]
Smo regulates expression of miR-378. [score:4]
How to cite this article: Hyun, J. et al. MicroRNA-378 limits activation of hepatic stellate cells and liver fibrosis by suppressing Gli3 expression. [score:4]
To assess whether this reduction in levels of the miR-378 family also occurs in other types of liver injury mo dels, we examined the expression of miR-378 family members in livers from mice fed with a methionine/choline -deficient diet supplemented with 0.1% ethionine (MCDE), which causes the non-alcoholic steatohepatitis (NASH) that accompanies hepatic fibrosis (n=4 per group) 9. Compared with livers of chow-fed mice, livers of MCDE-fed mice contained significantly increased expression of fibrotic markers including vimentin, tgf-β, α-sma and col1α1 (Fig. 9a). [score:4]
org) predicted that the miR-378 family targets human gli3 and gli2 mRNA and mouse gli3 and gli2 mRNA. [score:3]
Although neither miR-378b nor miR-378d binds to gli2 and gli3, expression of both was changed in the injured liver, suggesting that they might have specific roles in the liver. [score:3]
Mutant vectors lacking the miR-378 -binding site were produced by site-directed mutagenesis using a QuikChange Site-Directed Mutagenesis Kit (Stratagene, Agilent) in accordance with the manufacturer's instructions. [score:3]
To identify the relevant target genes of the miR-378 family, we conducted bioinformatic analysis using http://www. [score:3]
We found that miR-378a-3p, miR-378b and miR-378d were significantly downregulated at day 7 compared with day 0 of culture (Fig. 2b). [score:3]
MiR-378 family was downregulated in injured livers of CCl [4] -treated mice. [score:3]
Microarray and qRT–PCR analyses showed that the expressional level of miR-378a-5p was not significantly changed in fibrotic liver, although it was transcribed together with miR-378 a-3p (Supplementary Fig. 3). [score:3]
Decreased expression of the miR-378 family in aHSCs. [score:3]
In addition, we examined the expression of miR-378 family members in different types of liver cells, including hepatocytes, quiescent (day 0) HSCs (qHSCs) and liver sinusoidal endothelial cells (LSECs), primarily isolated from livers of normal mice. [score:3]
Smo influences expression of miR-378. [score:3]
As the aHSC is a major ECM-producing cell contributing to liver fibrosis 18 19, we examined the expression of miR-378 family members in LX2, a human aHSC line. [score:3]
Expression of all of three miR-378 family members was reduced to a greater extent in LX2 than in HepG2, a human hepatocyte cell line (Fig. 2a). [score:3]
The expression of miR-378a-3p, miR-378b and miR-378d was also lower in primary aHSCs isolated from CCl [4] -treated mice than inactivated cells from corn-oil -treated mice (Fig. 2c). [score:3]
This decreased expression of the miR-378 family was validated in fibrotic livers of mouse mo dels with hepatic injury and also in aHSCs. [score:3]
Target genes of human and mouse miR-378 were predicted by bioinformatic analysis using the online database http://www. [score:3]
Expression of miR-378 declines in injured liver of MCDE-fed mice and of patients with HCC. [score:3]
Expression of miR-378 is reduced during HSC activation. [score:3]
As members of the same miRNA family with different seed sequences bind to different targets 33, it seems that miR-378b and miR-378d do not bind to the 3′-UTR of gli3 and gli2 mRNA. [score:3]
Expression of all three miR-378 family member was greater in qHSCs than in primary LSECs (Fig. 2d). [score:3]
revealed that miR-378a-3p, not miR-378b or miR-378d, directly bound to gli3 but not gli2 mRNA, and that both of the two binding sites of the gli3 mRNA were active (Fig. 3c and Supplementary Fig. 4). [score:2]
This reduced expression of miR-378 family members was validated by real-time quantitative reverse transcriptase–PCR (qRT–PCR) analysis, which showed that miR-378a-3p was significantly decreased, and miR-378b and miR-378d tended to be reduced in fibrotic livers compared with controls (n=4 per group) both at 6 and 10 weeks (unpaired two-sample Student's t-test, P<0.05) (Fig. 1c). [score:2]
To examine the effect of miR-378 in vivo, 6-week-old mice received 0.4 ml kg [−1] body weight of CCl [4] (Sigma-Aldrich) dissolved in corn oil by i. p. injection, three times a week for 2 weeks 60 61. [score:1]
A previous study also reported that the miR-378 significantly declined in liver tissues of rat with dimethynitrosamine (DMN) -induced hepatic fibrosis 32. [score:1]
However, our luciferase reporter assay showed that only miR-378a-3p, and not miR-378b or miR-378d, bound directly to the 3′-UTR region of gli3 mRNA in mouse (Fig. 3 and Supplementary Fig. 4). [score:1]
Level of miR-378 declines in MCDE-fed mice and human HCC. [score:1]
MiR-378 binds directly to Gli3. [score:1]
To evaluate the effect of miR-378 on HSC activation, LX2 cells (1.5 × 10 [5] per well) cultured for 24 h were transfected with 20 nM of miR-378 mimic (AccuTarget human miRNA-378a-3p mimic, Bioneer) or 20 nM of scrambled miRNA (miRNA mimic negative control 1, Bioneer) as a negative control using Lipofectamine RNAi/MAX transfection reagent (Invitrogen, Life Technologies, Carlsbad, CA, USA), according to the manufacturer's instructions. [score:1]
These results suggested that the miR-378 family is involved in HSC activation. [score:1]
In addition, levels of the miR-378 family were also low in injured livers of mice fed for 3 or 4 weeks on an MCDE diet. [score:1]
The sequences of the miR-378 -binding sites of the 3′-UTR of gli3 and gli2 were confirmed by sequencing analysis (Macrogen, Seoul, Korea). [score:1]
Mouse miR-378b and miR-378d have a similar sequence and structure to mouse miR-378a-3p, but a different seed sequence. [score:1]
The 3′-UTR of mouse gli3 and gli2, containing binding sites for mouse miR-378, were amplified by PCR using mouse gDNA. [score:1]
Data for in vivo effect of miR-378 in the liver were first analysed with the non-parametric Kruskal–Wallis test and then the differences between subgroups were further analysed by the two-sample Student's t-test. [score:1]
[1 to 20 of 44 sentences]
7
[+] score: 110
It was reported miR-378 overexpression attenuated high glucose -suppressed osteogenic differentiation through targeting CASP3 and activating PI3K/Akt signaling pathway [29]. [score:7]
The results showed that the expression level of miR-378 mimic group was significantly higher than that of negative control, and the expression of miR-378 inhibitor group was lower than that of negative control (Figure 6). [score:7]
After BMMSCs were transfected with miR-378 mimics, miR-378 inhibitor, or negative controls, VEGF expression was analyzed by Western blot. [score:5]
LEE found that miR378 could promote cell survival, tumor growth, and angiogenesis by targeting SuFu and Fus-1 expression [28]. [score:5]
And after the 2-day, 7-day, and 14-day transfection of miR-378 inhibitor, VEGF and ANG-1 expression decreased to 2-fold almost (Figure 5(a)). [score:5]
After BMMSCs were transfected with miR-378 mimics, miR-378 inhibitor, or negative controls, miR-378 level, Runx2, Bmp2, Ocn, VEGF, angiopoietin 1 (Ang1), and Col I were examined by qRT-PCR after BMMSCs were transfected with miR-378 mimics, miR-378 inhibitor, or negative controls. [score:5]
After BMMSCs were transfected with miR-378 mimics, miR-378 inhibitor, or negative controls, VEGF expression was analyzed. [score:5]
Through target gene prediction, miR378 was chosen as the key factor to regulate both osteogenesis and angiogenesis. [score:4]
And the result showed that after 7-day and 14-day induction, miR378 expression was significantly higher than control (Figure 2(c)). [score:3]
Through target gene prediction analysis, miR378 was predicted as an intersection of Wnt and MAPK signaling pathway. [score:3]
The osteogenetic markers showed significantly higher after miR378 transfection indicated BMMSCs to get stronger osteoblast capacity with overexpression of miR378. [score:3]
Briefly, the transfection reagent was diluted in α-MEM (Gibco BRL) and mixed with 50 nM miR-378 mimic, 100 nM miR-378 inhibitor, or with the same concentration of the miR -negative control. [score:3]
Contrarily, after the 14-day transfection of miR-378 inhibitor in BMMSCs, ALP and alizarin red staining were significantly weaker than control (Figure 3(c)). [score:3]
We enhanced osteogenesis and angiogenesis simultaneously in BMMSCs through overexpression of miRNA378 in vitro and provided a potential gene tool choice for bone regeneration. [score:3]
We promoted osteogenesis-angiogenesis coupling in BMMSCs through overexpression of miRNA378 in vitro and provided a potential gene tool choice for bone regeneration. [score:3]
hBMMSCs were transfected with miR-378 mimics, miR-378 inhibitor, or negative controls (Guangdong Ruibo, China) using siPORT NeoFX transfection agent (Ambion, Applied Biosystems, USA) and following the manufacturer's instructions. [score:3]
The increased mRNA level of VEGF and ANG1/2 demonstrated that BMMSCs with overexpression of miRNA378 had enhanced angiogenic capacity. [score:3]
On the contrary, the miR378 level decreased 4–6-fold after the 2-day, 7-day, and 14-day transfections of miR378 inhibitor (Figure 3(a)). [score:3]
After the BMMSCs were transfected with miR-378 mimics, miR-378 inhibitor, or negative controls, VEGF secretion was analyzed. [score:3]
On the contrary, after transfection of miR-378 inhibitor, the number of branches, branches, nodes, mesh number, and mesh area was less than those of the negative controls (Figure 4(b)). [score:3]
And after the transfection of miR378 inhibitor in BMMSCs, VEGF secretion was significantly less than the control (Figure 5(b)). [score:3]
In order to detect the effect of miR-378 on the blood vessels, we transfected BMMSC cells with miR-378 mimetic, miR-378 inhibitor, or negative controls, respectively. [score:3]
BMMSCs were cultured for the third generation and then transfected with BMRCs by miR-378 mimetic, miR-378 inhibitor, or negative controls for subsequent experiments. [score:3]
Besides osteogenetic gene, angioblastic gene VEGF and ANG-1 expression increased significantly after 2-day, 7-day, and 14-day transfection of miR-378 mimics, compared with control. [score:2]
Therefore, we chose miR378 as a regulator to promote osteogenesis and angiogenesis simultaneously. [score:2]
After 6-hour, 12-hour, 24-hour, 48-hour, and 60-hour transfection of miR378 mimics or inhibitor in BMMSCs, VEGF secretion was assayed by ELISA. [score:2]
In vitro experiment, angiogenesis and osteogenesis were positively regulated by miR378 in BMMSCs. [score:2]
From previous reports, miR378, miR214, and miR155 were greatly affected on both osteogenesis and angiogenesis processes. [score:1]
Meanwhile, we also tested the miR378 level. [score:1]
The results showed that VEGF secretion was significantly more than control after miR378 mimic transfection. [score:1]
To test the effect of miR378 on osteogenesis, we transfected BMMSCs with miR378 mimics. [score:1]
miR378 has been reported as a key factor involved in sorts of cellular and organic metabolic processes. [score:1]
In this work, we tried to identify miR378 as a choice of osteogenesis-angiogenesis coupling for bone regeneration. [score:1]
To verify miR378 as osteogenesis-angiogenesis coupling, we tested the osteogenetic gene markers including Runx2, OCN, ALP, and BMP2, in which osteogenetic gene played important roles in osteogenesis and bone formation [5, 6, 11, 30]. [score:1]
The results showed that the number of branches and the length of branches were significantly higher than those of negative controls after transfection of miR-378 mimics. [score:1]
miR378 is believed as an expected factor to promote bone through increasing angiogenesis and osteogenesis simultaneously. [score:1]
3.1. miR378 Was Involved in Osteogenesis of BMMSCs. [score:1]
After the 14-day transfection of miR-378 mimics in BMMSCs, ALP and alizarin red staining were significantly stronger than control. [score:1]
Increased Angiogenesis Related to miR378 Positively. [score:1]
Increased Osteogenesis Related to miR378 Positively. [score:1]
We identified miR378 as angiogenesis-osteogenesis coupling in this article. [score:1]
[1 to 20 of 41 sentences]
8
[+] score: 86
THP-1 cells transfected with anti-miR-146a showed an upregulation in 5 of 13 predicted target genes (ERC1, FN1, RASAL2, TRAF2, TRAF6) and transfection with anti-miR-378 resulted in an upregulation of 4 out of 6 predicted targets (ERC1, FKBP5, MAP3K7IP3, NFKB2). [score:11]
0031151.g004 Figure 4 Fold-changes of target gene transcripts, as quantified via TaqMan® real time PCR in THP-1 cells, transfected with pre-miR-129-5p and stimulated with MDP, transfected with anti-miR-146a and stimulated with TNF-a and transfected with anti-miR-378 and stimulated with TNF-α are displayed (green = downregulation, yellow = no regulation, red = upregulation, grey = not detected). [score:10]
Fold-changes of target gene transcripts, as quantified via TaqMan® real time PCR in THP-1 cells, transfected with pre-miR-129-5p and stimulated with MDP, transfected with anti-miR-146a and stimulated with TNF-a and transfected with anti-miR-378 and stimulated with TNF-α are displayed (green = downregulation, yellow = no regulation, red = upregulation, grey = not detected). [score:10]
The miRanda mo del predicted 3736, 2763 and 2229 targets, miRBase predicted 999, 1038 and 1038, PicTar predicted 290, 157 and 0, PITA predicted 14, 59 and 62 targets and TargetScanS predicted 0, 37 and 0 targets for miR-129-5p, miR-146a and miR-378 respectively. [score:9]
miR-378 showed a pattern similar to miR-146a (Listeria monocytogenes: 8.26-fold upregulation, p = 0.0418; TNF-α: 15.69-fold upregulation, p = 0.0297). [score:7]
Interestingly, miR-378 exhibited this similarity on target-gene level as well: 97 of 117 target genes showed regulation in the same direction (out of 132 genes analyzed, where 15 were not detectable), supporting the hypothesis of miRNAs acting in functional clusters. [score:7]
The complexity and the potential involvement of interaction partners which were not monitored in this study is demonstrated by the example of nucleotide -binding oligomerization domain containing 2 (CARD15/NOD2): It is downregulated upon transfection of THP-1 cells with pre-miR-129-5p in the presence of MDP, but upregulated upon transfection with anti-miR-146a or anti-miR-378 in the presence of TNF-α. [score:7]
A cluster analysis of inductions (Figure 4) revealed strong similarities between the two miRNAs that were regulated in response to TNF-α (anti-miR-146a and anti-miR-378; Figure 1), while pre-miR-129-5p exhibited a approximately opposite patter of induced target genes. [score:4]
Based on its signature similarity to miR-146a, miR-378 was selected to be further analyzed on target gene level. [score:3]
To display their relative endogenous expression, miR129-5p, miR-146a and miR-378 are highlighted. [score:3]
To assess the impact of the presented miRNA patterns, three exemplary miRNAs were selected for further analysis of their impact on potential target transcripts, associated to inflammatory processes: hsa-miR-129-5p, hsa-miR-146a and hsa-miR-378. [score:3]
From the range of predicted target genes for miR-129-5p, miR-146a and miR-378, a subset of closely interconnected genes, functionally relevant to several inflammatory pathways (e. g. upstream of NFκB activation and/or MAP kinase activation) and interaction partners of these genes were selected for subsequent verification. [score:3]
The profile showed that miR-129-5p was present in low levels (0.02% of miR-150) while miR-146a and miR-378 were expressed at higher levels (both located within the top 15 [th] percentile; Figure S2). [score:3]
Therefore, miR-129-5p was selected to be experimentally increased by transfection of THP-1 cells with pre-miR-129-5p in contrast to miR-146a and miR-378 which were selected to be experimentally decreased by transfection with anti-miR-146a and anti-miR-378, respectively. [score:1]
Table S1, illustrated by fold changes in response to transfection with pre-hsa-miR129, anti-hsa-miR146a and anti-hsa-miR378. [score:1]
Quantitative data for selected transcripts after transfection with pre-miR-129-5, anti-miR-146a and anti-miR-378 is presented in Figure S4. [score:1]
When transfected into monocytes, we observed that the effect of pre-miR-129-5p on transcript levels after MDP-stimulation represents almost the opposite to the effect observed when transfecting cells with anti-miR-146a and anti-miR-378 after TNF-α stimulation (Figure 4). [score:1]
THP-1 cells were stimulated with the corresponding stimulus to reflect the initial result in primary cells (MDP for cells transfected with pre-hsa-miR129-5p; TNF-α for cells transfected with anti-has-miR146a and anti-has-miR378). [score:1]
Synthetic pre-miR-129-5p, pre-miR-ctrl, anti-miR-146a, anti-miR-378 and anti-miR-ctrl were purchased from Ambion (AppliedBiosystems). [score:1]
[1 to 20 of 19 sentences]
9
[+] score: 69
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-21, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-28, hsa-mir-30a, hsa-mir-96, hsa-mir-98, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30d, hsa-mir-34a, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-23b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-194-1, hsa-mir-194-2, hsa-mir-200a, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-342, hsa-mir-148b, hsa-mir-338, hsa-mir-335, hsa-mir-196b, hsa-mir-484, hsa-mir-486-1, hsa-mir-1271, hsa-mir-378d-2, bta-mir-26a-2, bta-mir-103-1, bta-mir-148a, bta-mir-21, bta-mir-27a, bta-mir-30d, bta-mir-484, bta-mir-99a, bta-mir-125a, bta-mir-125b-1, bta-mir-145, bta-mir-199a-1, bta-mir-27b, bta-mir-98, bta-mir-148b, bta-mir-200a, bta-mir-30a, bta-let-7a-1, bta-mir-342, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-125b-2, bta-mir-34a, bta-mir-99b, hsa-mir-885, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-143, bta-mir-152, bta-mir-16a, bta-mir-194-2, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-199a-2, bta-mir-26a-1, bta-mir-28, bta-mir-335, bta-mir-338, bta-mir-378-1, bta-mir-486, bta-mir-885, bta-mir-96, bta-mir-1271, bta-mir-2299, bta-mir-199c, bta-mir-1388, bta-mir-194-1, bta-mir-378-2, bta-mir-3431, hsa-mir-378c, hsa-mir-4286, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, bta-mir-4286-1, bta-mir-4286-2, hsa-mir-378j, bta-mir-378b, bta-mir-378c, hsa-mir-486-2, bta-mir-378d, bta-mir-194b, bta-mir-194b-2
Our analysis indicates that, about 3594 genes could be targeted by the eleven up-regulated miRNAs (bta-199a-3p, miR-98, miR-378, miR-21-5p, miR-148b, miR-4286, miR-885, miR-196a, miR-23b-3p, bta-miR-199c and miR-3431) whereas 1163 genes could be targeted by the three down-regulated miRNAs (bta-miR-335, miR-200a and bta-miR-2299-5p) in linseed oil -treated cows. [score:11]
FADS2, which cause desaturation of FAs is a direct target of bta-miR-98a (IPA knowledge base) while miR-378 can regulate adipocyte differentiation by directly targeting PPARγ and C/EBPα (CCAAT/enhancer -binding protein α), which promote lipogenesis stimulation and increase lipid droplet size in developing adipocytes when overexpressed [69]. [score:10]
Seven miRNAs including six up-regulated (bta-miR-199c, miR-199a-3p, miR-98, miR-378, miR-148b and miR-21-5p) and one down-regulated (bta-miR-200a) were found to be regulated (P < 0.05) by both treatments, and thus considered core differentially expressed (DE) miRNAs. [score:9]
The expression of seven miRNAs including six up-regulated (bta-miR-199c, miR-199a-3p, miR-98, miR-378, miR-148b and miR-21-5p) and one down-regulated (bta-miR-200a) were significantly affected by both treatments. [score:9]
Out of this number, 11 were up-regulated (bta-miR-4286, miR-885, miR-199c, miR-199a-3p, miR-3431, miR-98, miR-196a, miR-378, miR-23b-3p, miR-148b and miR-21-5p) while only 3 were down-regulated (miR-200a, miR-335 and miR-2299-5p) (Table  2). [score:7]
Seven of the DE miRNAs by safflower oil treatment (6 up-regulated: bta-miR-199c, miR-199a-3p, miR-98, miR-378, miR-148b, miR-21-5p; one down-regulated: bta-miR-200a) were also significantly affected by linseed oil supplementation. [score:7]
When compared with the control period (day-14), we identified a total of 22 DE miRNAs at day+28 including 10 up-regulated (bta-miR-199c, miR-199a-3p, miR-98, miR-378, miR-21-5p, miR-148b, miR-34a, miR-152, miR-16a, and miR-28) and 12 down-regulated (bta-miR-200a, miR-145, miR-99a-5p, miR-125b, miR-99b, miR-125a, miR-96, miR-484, miR-1388-5p, miR-342, miR-486 and miR-1271) (Table  2). [score:6]
Quantitative RT-PCR was used to validate the expression of select differentially expressed miRNAs (bta-miR-199a-3p, miR-378, miR-34a and miR-98). [score:5]
Real-time quantitative PCR (qPCR) was used to validate the expression levels of selected DE miRNAs (bta-miR-199a-3p, miR-34a, miR-378 and miR-98) identified in this study (Fig.   5). [score:3]
For example, bta-miR-199a and bta-miR-378 were differentially expressed at day+28 compared with day-14 in both treatments (P < 0.05) after RNA-sequencing and confirmed by qPCR. [score:2]
[1 to 20 of 10 sentences]
10
[+] score: 64
In our study, although we found that the expression of miR-378 was downregulated in GC tissues, no relationship was found between the expression of miR-378 and the clinicopathological features of GC. [score:8]
In conclusion, our systemic review identified five upregulated miRNAs (miR-21, miR-106b, miR-17, miR-18a and miR-20a) and one downregulated miRNA (miR-378) that are potential novel biomarkers for GC. [score:7]
We identified the five miRNAs that were most consistently upregulated (miR-21, miR-106a, miR-17, miR-18a and miR-20a) and two most consistently downregulated (miR-378 and miR-638) in at least four profiling studies. [score:7]
The exogenous expression of miR-378 markedly suppresses the proliferation of GC cells by suppressing CDK6 and VEGF signaling [44]. [score:7]
The results showed that miR-378 was downregulated in GC tissues, whereas the other five miRNAs (miR-21, miR-106b, miR-17, miR-18a and miR-20a) were upregulated in GC (Figure 2). [score:7]
The most consistently downregulated miRNA in this systematic review was miR-378, which was found to be downregulated in five studies. [score:7]
It is also reported that miR-378 is significantly downregulated in colorectal cancer, and may play an important tumor suppressor role in this cancer [45]. [score:6]
0073683.g002 Figure 2 Using U6 as a normalization control, the expression of miR-21, miR-106b, miR-17, miR-18a and miR-20a was significantly higher in GC tissues, while the expression of miR-378 was significantly lower. [score:5]
However, no relationship was found between the expression of miR-378 and the clinicopathological features of GC. [score:3]
Expression levels of miR-21, miR-106b, miR-17, miR-18a, miR-20a and miR-378 in GC and adjacent noncancerous tissue samples. [score:3]
However, other studies have found that miR-378 may have oncogenic activity in other cancer types [46]– [49]. [score:1]
Three of these miRNAs were reported in five microarray studies (miR-21, miR-106b and miR-378), four were reported in four studies (miR-17, miR-18a, miR-20a and miR-638), and seven were reported in three studies (miR-19a, miR-20b, miR-25, miR-30d, miR-923, miR-375, and miR-148a). [score:1]
Therefore, the exact role of miR-378 in carcinogenesis needs to be further elucidated. [score:1]
For example, serum miR-21 was significantly elevated in perioperative serum from adenomas and colorectal cancer (CRC), and was an independent prognostic marker for CRC [50], [51]; Plasma miR-106b, together with miR-20a and miR-221 have the potential as novel biomarkers for early detection of gastric cancer [40]; Circulating miR-17 may used as a novel noninvasive biomarker for nasopharyngeal carcinoma [52], gastric cancer [53] and CRC [54]; Serum miR-18a may be used as a novel biomarker in breast cancer [55], colorectal cancer [56], hepatocellular carcinoma [57], and pancreatic cancer [58]; Circulating miR-378 may be used as a biomarker in renal cell carcinoma [59] and gastric cancer [60]. [score:1]
[1 to 20 of 14 sentences]
11
[+] score: 52
To find out whether expression of miR-378 is relevant to the repression of dorsal forebrain mRNAs, we performed the knockdown of miR-378 for VPA using an antisense morpholino oligonucleotide (MO) targeting the miR-378 (miR-378 MO). [score:6]
To validate the miR-378 expression, we performed RT-qPCR analysis and the expression pattern is consistent with the array results (Figure 5d). [score:5]
To find out common and different miRNAs among three compounds, we performed Venn analysis and strikingly miR-378 was commonly regulated by all of the three HDAC inhibitors (Figure 5c). [score:4]
In general, knockdown of the miR-378 counteracted the effects of VPA on the gene expression level of OTX2 and SOX10 (Figure 5e). [score:4]
Surprisingly, knockdown of miR-378 reverses the expression of OTX2, EMX2, SOX10 and DLX4 at mRNA level. [score:4]
Previously, miR-378 has been studied in the context of cell survival, colony formation and tumor growth through direct inhibition of vimentin (VIM). [score:4]
The RT-qPCR analysis showed miR-378 knockdown overexpresses the dorsal telencephalon genes such as EMX2, OTX2 and SOX10, whereas the ventral telencephalon gene DLX4 was repressed (Figure 5d). [score:4]
66, 74 VPA treatment increases miR-378 and represses VIM in this study and further to examine the effect of miR-378 expression, we performed transient knockdown of miR-378. [score:4]
The morphological analysis showed VPA treatment inhibits the neuronal projections, whereas after miR-378 knockdown neuronal extensions were observed (Figure 5f). [score:4]
MOs of has-mir-378 (Gene Tools, LLC, Philomath, OR, USA) complementary to specific sequence from 5′ to 3′ ACACACAGGACCTGGAGTCAGGAGC and non-target sequence (scrambled) CCTCTTACCTCAGTTACAATTTATA were used. [score:3]
70, 71, 72 Most importantly, we found all the three HDACi overexpressed miR-378 in this study. [score:3]
TaqMan MicroRNA Assays (Applied Biosystems) were performed for miRNA 378 expression using hsa-miR-26b (TM-000407) and hsa-miR-378 (TM-000567). [score:2]
Notably, the role of VPA in axonogenesis and repression of forebrain markers through miR-378 has never before been demonstrated by any in vitro study. [score:1]
These findings suggest an important role of miR-378 for the process of neurogenesis. [score:1]
Also shown in Figure 5f is the cellular uptake of miR-378 MO and scrambled MO. [score:1]
MO of hsa-mir-378. [score:1]
For immunocytochemistry analyses, day 12 EBs (control, VPA and hsa-mir-378 -treated group) were plated on fibronectin-coated coverslips. [score:1]
[1 to 20 of 17 sentences]
12
[+] score: 51
In summary, our real-time PCR results identified alterations of miRNA expression in CRC with two down-regulated miRNAs (miR-378* and miR-145), which may be novel candidate biomarkers for CRC. [score:6]
miR-378 inhibits progression of human gastric cancer MGC-803 cells by targeting MAPK1 in vitro [19]. [score:5]
We compared the expression of miR-378* in different clinical stages and found that miR-378* is downregulated in all stages. [score:5]
Furthermore, miRNA-profiling study proved that miR-378 was significantly upregulated in cachexia related to enhanced adipocyte lipolysis in human cancer [21]. [score:4]
Conditional logistic regression results confirmed that miRNA-378 and miRNA-145 expression profile was statistically significant. [score:3]
Thus, previous studies reveals that change of miR-378 expression has been previously reported in nasopharyngeal cancer. [score:3]
Notably, our current study showed that discriminant analysis based on expression data revealed that miR-378* can distinguish CRC from normal tissues. [score:3]
Yu BL et al. reported that repressing TOB2 expression would cause miR-378 to function as an oncomiR in nasopharyngeal carcinoma [23]; miR-378/ATP also binds Cassette Transporter G1-Signaling pathway [24]. [score:3]
Zhang GJ et al. also indicated that miR-378 is an independent prognostic factor that inhibits cell growth and invasion in CRC. [score:3]
Expression levels of miR-378* and miR-145 varied in different clinical stages. [score:3]
Futher analysis reveals miR-378* and miR-145 exhibits potential as a good diagnostic and prognostic marker. [score:1]
Although, both miR-145 and miR-378* contribute to the probability of CRC, comparison between the roles of miR-145 and miR-378* in the CRC progression will give more information to the cell transcription mechanisms. [score:1]
To verify the diagnostic value of miR-378*, Fisher discriminant analysis was analyzed to predict the category and determine the diagnostic ability of miR-378*. [score:1]
Discriminant analysis for miR-378*. [score:1]
Conditional logistic regression was used to screen the factors contributed to the occurrence of tumor, among which miR-145 and miR-378* were found being statistically significant. [score:1]
miR-378 also promotes BMP2 -induced osteogenic differentiation of mesenchymal progenitor cells [20]. [score:1]
After a series of selection processes independently with enter method and conditional forward method in conditional logistic regression, we found nine statistically significant miRNAs in enter method, namely, miR574-3p, miR422a, miR490-3p, miR-374b, miR-133a, let7g, miR-378*, miR-9* and miR-378i. [score:1]
These results were consistent with those from the study of Zhang et al., who indicated that miRNA378 is a reliable, hemolysis-independent biomarker for CRC [13]. [score:1]
MiRNA-145 and miRNA-378* are potential biomarkers for early detection of CRC, which may help in diagnosing CRC in early period. [score:1]
This result is important for the potential role of new molecular gene miR-378* in future diagnostic processes in the absence of effective early diagnostic biomarkers. [score:1]
On the other hand, we found seven statistically significant miRNAs, namely, miR-145, miR-363, miR-378*, miR-137, miR-100, miR-125a-5p, miR-143 in conditional forward method. [score:1]
The results indicated that miR-378* is the kept variable with statistical significance to distinguish CRC from normal tissues (P < 0.05; odds ratio = 4.6; 95% CI of odds ratio = 1.25 to 16.84). [score:1]
Preliminary results showed that the level of miR874-3p, miR-422a, miR-490-3p, miR-374b, miR-133a, let-7 g, miR-378, miR-9*, and miR-378i were all deregulated in the CRC tissues compared with the neighboring noncancerous colorectal tissues (all P < 0.05) (Figure  2). [score:1]
[1 to 20 of 23 sentences]
13
[+] score: 45
Interestingly, miRNAs belonging to the miR-378 family, recently suggested to be essential in normal skeletal muscle development [37], were markedly down-regulated in both ARMS and ERMS tumours (see Additional file 1: Table S1). [score:5]
Target genes of the miR-378 family were predicted using TargetScan Human 6.2 (http://www. [score:5]
Likewise, the expression pattern of miR-378 in porcine longissimus muscles is closely related to myogenesis regulation, mainly with fibre formation [37]. [score:4]
MiR-378 molecules were strongly under-expressed both in ARMS and ERMS tumours, this showing that the regulation of these miRNAs does not differentiate among RMS subtypes. [score:4]
To our knowledge, this is the first study that shows a marked down-regulation of miR-378 family members in RMS. [score:4]
Interestingly, members of the miR-378 family presented as a possible target the insulin-like growth factor receptor 1 (IGF1R), a key signalling molecule in RMS. [score:3]
miR-378 molecules are encoded by different genes but they share identical seed sequences for mRNA target recognition. [score:3]
Additional file 1: Table S1: Expression of miR-378 family members in RMS tumours. [score:3]
The same miR-378 target gene list was used as the starting dataset for the generation of a Functional Interaction network analysis and related Gene Ontology enrichment analysis as described [34, 35]. [score:3]
As reported in Table  4, miR-378 family members are transcribed from different loci but they exhibit seed sequence homology for mRNA target recognition. [score:3]
We focused on miR-378a-3p, a key regulatory molecule of miR-378 family, investigating the biological relevance of this miRNA in RMS tumours by performing target gene prediction and functional pathway analysis. [score:2]
Cells (5×10 [3]) were plated onto 96-well plates in sextuplicates and, after 24 h, treated with 5-aza-dC or transfected with synthetic miR-378-3p; untreated and blank cell-free controls were included. [score:1]
miR-378-3p induces apoptosis and impairs cell migration. [score:1]
Annotation and enrichment of functional pathways associated with the miR-378 target genes were evaluated using the Reactome database and associated analytical tools (http://www. [score:1]
The members of the miR-378 family have FC values always negative and significant in both comparisons, indicating a strong under -expression in the investigated ARMS and ERMS samples. [score:1]
The presence of CpG sites in the promoter regions of the miR-378 family members has recently been suggested and partially experimentally demonstrated in other neoplasms [47, 59– 61]. [score:1]
In C2C12 murine proliferating myoblasts, up-modulation of miR-378 has been proposed as allowing the efficient myotube formation by repressing antagonists of differentiation, like MyoR [57]. [score:1]
[1 to 20 of 17 sentences]
14
[+] score: 42
Using qPCR analysis to validate the results, we confirmed that miR-378 is up-regulated by E2 (Fig.   4B) and that this up-regulation is via the ESR1 pathway since E2 induction of miR-378 is not observed when MASE cells were pre -treated with an ESR1 antagonist (Fig.   4C). [score:7]
E2 suppresses Dab2 by up-regulation of miR-378. [score:6]
An E2 time-course experiment shows that E2 induction of miR-378 occurs within the same time frame as Dab2 transcript suppression (Fig.   4A,D) and using miRNA mimic assays, miR-378 was confirmed to be capable of suppressing DAB2 expression (Fig.   4E). [score:6]
Since our goal was to determine if miRNA up-regulation by E2 is a possible mechanism by which Dab2 can be decreased, we initially only focused on the top hit candidate miR-378, but it is nevertheless possible that Dab2 suppression is a combined effort among multiple miRNAs. [score:6]
Figure 4E2 suppresses Dab2 via up-regulation of miR-378. [score:6]
The ESR1 pathway mediates Dab2 suppression via E2 induction of miR-378, where Dab2 transcripts were significantly decreased within 3 h and maximal reduction in DAB2 protein was observed after 48 h. Finally, we have demonstrated that E2 suppression of Dab2 occurs both in vivo and in vitro, and across many cell types including mouse FTE and human ovarian and breast cancer cells. [score:5]
Of the miRNAs that had the highest increase in response to E2 (>2-fold change), miR-378 was the only miRNA that had a seeding sequence capable of targeting both human and mouse Dab2 transcripts (Supp. [score:3]
This is the first time miR-378 is reported to be E2 inducible via the ESR1 pathway and a regulator of Dab2. [score:2]
, n = 3. *p-value < 0.05 miR-378 significantly different relative to scrambled; two-way ANOVA. [score:1]
[1 to 20 of 9 sentences]
15
[+] score: 39
The expression profile of the miRNAs that were strongly up-regulated during adipogenesis (miR-642a-3p, miR-378, miR-30a, miR-30b, miR-30c, miR-30d, miR-30e, and miR-193b) was validated by quantitative PCR (qPCR; Additional file 4). [score:6]
In addition to miR-378, our data confirmed that the miR-30 family was up-regulated in adipogenesis (Table 1). [score:4]
Indeed, miR-378 appears to target nephronectin, which is a positive regulator of osteoblastic differentiation. [score:4]
In addition to miR-30 miRNAs, we identified potent up-regulation of other miRNA families, such as miR-378 (35.7-fold), during adipogenic differentiation. [score:4]
Up-regulation of miR-642a-3p, miR-378/378* and miR-30 miRNAs suggests their contribution to adipogenesis. [score:4]
The level of expression of each gene in the pre-miR-30a condition was taken as 1. HEK-293T cells were co -transfected with either construct together with the following synthetic pre-miRNAs: negative control, miR-30a, miR-30d or miR-378 (as RUNX2 does not bear any putative binding site for this miRNA, miR-378 was used here as an additional control). [score:3]
The level of expression of each gene in the pre-miR-30a condition was taken as 1. HEK-293T cells were co -transfected with either construct together with the following synthetic pre-miRNAs: negative control, miR-30a, miR-30d or miR-378 (as RUNX2 does not bear any putative binding site for this miRNA, miR-378 was used here as an additional control). [score:3]
A role of decreased miR-378 expression in osteogenesis in the osteoblastic cell line MC3T3-E1 has been suggested recently [29]. [score:3]
Incidentally, miR-378 microRNAs, also highly regulated in our mo del, have a genomic location in intron 1 of PPARGC1B (Additional file 5) and miR-378 has already been described as positively regulated in adipogenesis (Additional file 3). [score:3]
Very recently, Gerin and co-workers [30] identified miR-378/378* as positive regulators of lipogenesis. [score:2]
As expected, miR-378 had no effect on luciferase activity. [score:1]
Synthetic miRNAs (miR-30a, miR-30d and miR-378) as well as negative control (miR-Neg) were purchased from Ambion. [score:1]
Genome-browser representation of reads matching (a) miR-642a and (b) miR-378. [score:1]
[1 to 20 of 13 sentences]
16
[+] score: 39
miRNA-378 could promote the expression of proto-oncogenes through targeted localization and inhibiting the BTG (B-cell translocation gene) prohibiting. [score:7]
It is reported that miRNA-378 could inhibit human GC MDC-803 cells by target MAPK1 in vitro, and promote BMP2-inducec osteogenic differentiation of mesenchymal progenitor cells [33]. [score:5]
In addition, miR-378 could be the downstream targeted site of the c-Myc oncoprotein, which was involved in stable transfection of miR-378 resulted in cell survival, tumor growth and angiogenesis [32]. [score:3]
Previous study found that the miRNA-378 expression levels could identify cancer patients and health individuals [15]. [score:3]
The miRNA-378 is an important tumor-related gene regulatory site. [score:2]
The pooled diagnostic value of miR-378 is higher than traditional clinical markers such as CEA and CA19-9 [28], indicating the relatively high accuracy of miRNA-378 as an early diagnosing biomarker of cancers. [score:1]
These possible mechanisms make miRNA-378 become a potential biomarker of detecting cancers. [score:1]
miRNA-378 also was reported to be increased in GC and CRC patients [17, 20]. [score:1]
Another study by Wang even found that the miRNA-378 levels were significantly decreased in the serum of RCC patients [25], and decreased levels were also found in patients with NPC (nasopharyngeal carcinoma) [16]. [score:1]
In conclusions, the overall diagnostic values of miR-378 in the present meta-analyses are moderate accurate for human cancers, especially for RCC; The source of specimen has an effect on the diagnostic accuracy. [score:1]
The SROC curve of miR-378 test for the diagnosis of various cancers (A) SROC curve of serum -based; (B) SROC curve of plasma -based). [score:1]
The miRNA-378 showed a moderate accuracy in detecting cancer patients. [score:1]
It suggests that the diagnostic cutoff values of miR-378 for detecting cancers is correlate to source of samples. [score:1]
Summary estimated of diagnostic performance of miR-378 for cancer detection. [score:1]
The diagnostic accuracy of miR-378 for cancers was relatively high. [score:1]
The future study should focus on the mechanism and combined effect of miRNA-378 and others miRNAs. [score:1]
The estimated diagnostic values of miR-378 for detecting cancers are shown in Table 2. The overall estimated sensitivity and specificity were 0.75 (95% CI: 0.71–0.78) and 0.74 (95% CI: 0.69–0.79). [score:1]
However, the diagnostic values of miRNA-378 remain inconsistent in different studies, which could be caused by the limitation of sample size, study group and cancers types [16, 17]. [score:1]
Our results found that miRNA-378 had a AUC of 0.81 as well as other cancer types of the present results. [score:1]
In the present meta-analysis, eight studies of the levels of miRNA-378 in the serum of RCC patients are included in the meta-analysis. [score:1]
The bias test shown no existence of publication bias (t = 0.09, P = 0.929) as indicated in Figure 5. Figure 5 In the present meta-analysis, twelve studies were included, and the pooled results including all studies showed miRNA-378 gave an AUC of 0.81 (95% CI:0.77–0.84) with a sensitivity value of 75% and specificity of 74% in identifying the patients with cancers from health individuals. [score:1]
We also found the source of specimen had an effect on the diagnostic value of miRNa-378. [score:1]
The SROC curve of miR-378 test for the diagnosis of various cancers. [score:1]
According to the criteria of high accuracy (PLR > 10, NLR < 0.1), the results of miR-378 are not high enough as expected. [score:1]
[1 to 20 of 24 sentences]
17
[+] score: 38
Emerging evidence demonstrates that miRNAs are critical regulators of lipid synthesis and FAO [81] resulting in defective cell metabolism and carcinogenesis [82] directly targeting key enzymes or transcription factors as oncogenes and tumor suppressors [81] as shown in Table  1. Table 1 miRNAs involved in cancer metabolic plasticity MiRNAs Target Reference miR-122 Cholesterol biosynthesis 88– 90 miR-370 Fatty acid oxidation, CPT1A [91] miR-378/378* Lipid metabolism, CrAT 92, 93 miR-335 Lipid metabolism and adipogenesis [94] miR-205 Lipid metabolism [95] miR-143 Adipocyte differentiation [96] miR-27 Adipolysis [97] miR-33a/b Cholesterol efflux and β-oxidation 98– 100 miR-185 Lipogenesis and cholesterogenesis [101] miR-342 Lipogenesis and cholesterogenesis [101] miR-124 CPT1A [27] miR-129 CACT 27, 102 MiR-122 was the first miRNA identified as tissue-specific, and it is the most abundant in liver involved in lipid metabolic reprogramming [83]. [score:9]
Moreover, Valentino et al. have demonstrated that the downregulation of hsa-miR-124-3p, hsa-miR-129-5p, and hsa-miR-378 induces an increase in both expression and activity of CPT1A, CACT, and CrAT in malignant prostate cells [22]. [score:6]
In breast cancer cells, a high level of miR-378* induces the metabolic shift from an oxidative to a glycolytic bioenergetics pathway by inhibiting the expression of two PGC-1β partners, ERRγ (estrogen-related receptor gamma) and GABPA (GA binding protein transcription factor, alpha subunit). [score:5]
Targets of miR-378 are also CRAT; indeed, it has been shown that mice genetically lacking miR-378 and miR-378* are resistant to high-fat-diet -induced obesity and display enhanced mitochondrial FA metabolism and elevated oxidative capacity of insulin-target tissue [90]. [score:5]
Another important miRNA regulating cell metabolism is miR-378/378*, embedded within gene encoding peroxisome proliferator-activated receptor gamma coactivator 1-beta (PGC-1β), a transcriptional regulator of oxidative energy metabolism. [score:3]
In addition, the carnitine system components are directly regulated by miR-370, miR-124 (CPT1A), miR-129 (CACT), miR-33a/b (CPT1A and CrAT), and miR-378 (CrAT) Cancer metabolic plasticity allows tumor cells to survive in the face of adverse environmental conditions. [score:3]
In addition, the analysis of human prostate cancer and prostate control specimens confirmed the aberrant expression of miR-124-3p, miR-129-5p, and miR-378 in primary tumors. [score:3]
In addition, the carnitine system components are directly regulated by miR-370, miR-124 (CPT1A), miR-129 (CACT), miR-33a/b (CPT1A and CrAT), and miR-378 (CrAT) MicroRNAs are transcribed by RNA polymerases II and III in pri-miRNAs, generating precursors that undergo a series of cleavage events to form mature microRNA. [score:3]
Eichner LJ miR-378(*) mediates metabolic shift in breast cancer cells via the PGC-1beta/ERRgamma transcriptional pathwayCell Metab. [score:1]
[1 to 20 of 9 sentences]
18
[+] score: 30
Eight miRNAs (miR-101, miR-107, miR-122, miR-29, miR-365, miR-375, miR-378, and miR-802), whose expression was found to be downregulated in c-Myc and/or AKT/Ras liver tumors, were selected and their tumor suppressor activity was assessed in c-Myc and AKT/Ras mice. [score:8]
miRNA Oncogene Growth Inhibition miR-101 c-Myc +++ AKT/Ras +++ miR-107 c-Myc + AKT/Ras ++ miR-122 c-Myc ++ AKT/Ras ++ miR-29 c-Myc ++ AKT/Ras + miR-365 c-Myc ++ AKT/Ras ++ miR-375 c-Myc + AKT/Ras +++ miR-378 c-Myc − AKT/Ras − miR-802 c-Myc ++ AKT/Ras − Taken together, the present results indicate that miR-378 does not possess tumor suppressor activity on c-Myc and AKT/Ras induced hepatocarcinogenesis in mice. [score:5]
Among all the miRNAs tested, overexpression of mir-378 had no or very limited activity in inhibiting c-Myc or AKT/Ras hepatocarcinogenesis in mice (Table 1 and Supplementary Figure 3A–3D). [score:5]
miRNA Oncogene Growth Inhibition miR-101 c-Myc +++ AKT/Ras +++ miR-107 c-Myc + AKT/Ras ++ miR-122 c-Myc ++ AKT/Ras ++ miR-29 c-Myc ++ AKT/Ras + miR-365 c-Myc ++ AKT/Ras ++ miR-375 c-Myc + AKT/Ras +++ miR-378 c-Myc − AKT/Ras − miR-802 c-Myc ++ AKT/Ras − Taken together, the present results indicate that miR-378 does not possess tumor suppressor activity on c-Myc and AKT/Ras induced hepatocarcinogenesis in mice. [score:5]
Indeed, when miR-378 was overexpressed in combination with c-Myc, all c-Myc/miR-378 injected mice developed palpable abdominal mass and became moribund by 6 weeks post injection. [score:3]
Lack tumor suppressor activity of miR-378 on c-Myc and AKT/Ras induced hepatocarcinogenesis. [score:3]
Similarly, all AKT/Ras/miR-378 injected mice developed lethal burden of liver tumors by 6.5 weeks post injection, and histologically AKT/Ras/miR-378 tumors were identical to AKT/Ras/pT3 tumors (Supplementary Figure 3A–3D). [score:1]
[1 to 20 of 7 sentences]
19
[+] score: 30
It is a direct target of miR-10b [63] and miR-128 [49], and is indirectly suppressed by miR-27 [46] and miR-378 [64]. [score:7]
In vivo supplementation with CoQ10 led to decreased expression of c-Jun and miR-378, increased ABCG1, macrophage cholesterol efflux, and RCT, and regression of aortic lesions [64]. [score:3]
Therefore, statins also decrease synthesis of CoQ10, which may lead to increased expression of miR-378 and, therefore, lower ABCG1. [score:3]
Coenzyme Q10 (CoQ10), an antioxidant and anti-inflammatory vitamin-like compound [74], was recently shown to enhance RCT by targeting miR-378 [64]. [score:3]
The authors go on to show that suppression of miR-378 by CoQ10 is mediated by the transcription factors c-Jun and activator protein 1 (AP-1) [64]. [score:3]
This increase was mediated by miR-378, such that CoQ10 reverses miR-378 -mediated inhibition of ABCG1, thus promoting cholesterol efflux. [score:3]
Altogether, these data support the ability of CoQ10 to promote RCT by targeting miR-378. [score:3]
Jeon T. II Park J. W. Ahn J. Jung C. H. Ha T. Y. Fisetin protects against hepatosteatosis in mice by inhibiting miR-378 Mol. [score:3]
Wang D. Yan X. Xia M. Yang Y. Li D. Li X. Song F. Ling W. Coenzyme Q10 promotes macrophage cholesterol efflux by regulation of the activator protein-1/microRNA-378/ATP -binding cassette transporter G1-signaling pathway Arterioscler. [score:2]
[1 to 20 of 9 sentences]
20
[+] score: 30
We found that c-Myc downregulation led to decreased expression of miR-17, miR-20a, miR-30a, miR-221, miR-222 and miR-378 (Fig. 5B), which were consistent with the effects of NC shown in Fig. 5A. [score:6]
We also observed that a specific group of miRNAs (miR-17, miR-20a, miR-30a, miR-221, miR-222 and miR-378), which were activated by c-Myc and executed part of c-Myc functions in leukemia development [11, 20, 21, 22], was markedly downregulated. [score:5]
We next examined the effects of NC on the expression of c-Myc activated miRNAs (miR-17, miR-20a, miR-30a, miR-221, miR-222 and miR-378), which were typically increased in leukemia and triggered to the development of leukemia [11, 20, 21, 22]. [score:4]
The expression of miR-17, miR-20a, miR-30a, miR-221, miR-222 and miR-378, which were reported to be dependent on c-Myc transcriptional activity [27, 48, 49, 50] and contribute the development of leukemia [11, 20, 21, 22], was examined in K562 cells treated with NC. [score:4]
To determine the expression level of mature miRNAs (miR-17, miR-20a, miR-30a, miR-221, miR-222 and miR-378) in K562 cells, All-in-One miRNA qRT-PCR Detection Kit (GeneCopoeia, Rockville, MD) was used following manufacturer’s protocol. [score:3]
The relative expression of miR-17, miR-20a, miR-30a, miR-221, miR-222 and miR-378 was detected by real-time qRT-PCR. [score:3]
We next explored the effects of c-Myc inactivation on the expression of the tumor associated miRNAs (miR-17, miR-20a, miR-30a, miR-221, miR-222 and miR-378) in K562 cells. [score:3]
Our results revealed that NC treatment decreased the relative levels of miR-17, miR-20a, miR-30a, miR-221, miR-222 and miR-378, among which miR-17 and miR-20a showed the sharpest decrement by 65.0 ± 0.6% and 62.6 ± 2.6%, respectively (Fig. 5A). [score:1]
0116880.g005 Fig 5(A) K562 cells were treated with 0, 4 or 8 μM NC for 2 days, the relative levels of mature miR-17, miR-20a, miR-30a, miR-221, miR-222 and miR-378 were detected by real-time qRT-PCR. [score:1]
[1 to 20 of 9 sentences]
21
[+] score: 27
Figure 4. The ‘extended VCR’ of stratum 2 (shared by Homo and Pelodiscus sequences): (a) miR-16 target site (also shown in Fig. 2e) and nearby target sites for miR-376a, miR-335-3p, miR-493 and miR-379 (the Xenopus sequence contains a 44-bp insertion at the site of the asterisk that includes two target sites for miR-335-3p are shown in red); (b) conserved pair of target sites for miR-320a and miR-182; (c) conserved triplet of target sites for miR-378, miR-99a and miR-30aA notable feature of stratum 2 is a pair of complementary sequences, 800 nucleotides apart, that are predicted to form the stems of a strong double helix (18 bp, –32.3 kcal/mol). [score:11]
Figure 4. The ‘extended VCR’ of stratum 2 (shared by Homo and Pelodiscus sequences): (a) miR-16 target site (also shown in Fig. 2e) and nearby target sites for miR-376a, miR-335-3p, miR-493 and miR-379 (the Xenopus sequence contains a 44-bp insertion at the site of the asterisk that includes two target sites for miR-335-3p are shown in red); (b) conserved pair of target sites for miR-320a and miR-182; (c) conserved triplet of target sites for miR-378, miR-99a and miR-30a A notable feature of stratum 2 is a pair of complementary sequences, 800 nucleotides apart, that are predicted to form the stems of a strong double helix (18 bp, –32.3 kcal/mol). [score:11]
The megaloop contains, among other features, a conserved pair of target sites for miR-320a and miR-182 (Fig.  4b) and a conserved triplet of target sites for miR-378, miR-99a and miR-30a (Fig.  4c). [score:5]
[1 to 20 of 3 sentences]
22
[+] score: 23
Gene ontology analysis has revealed miR-378 to target the mTOR signaling pathway while changes in miR-378 expression correlated with increases in lean body mass following 12 weeks resistance training (Davidsen et al., 2011). [score:5]
DEP domain containing MTOR-interacting protein (DEPTOR) is an endogenous inhibitor of mTORC1 and predicted target of miR-378. [score:5]
The transcription factor FOXO3 is also a predicted target of miR-378. [score:3]
The miR-378 was exclusively upregulated with post-exercise protein ingestion and was higher compared to placebo. [score:3]
In light of previous findings (Camera et al., 2015), the increase in miR-378 expression with protein provides a potential mechanism by which protein ingestion after concurrent exercise enhances mTORC1 signaling and rates of MPS. [score:3]
While there were no changes in FOXO3 abundance in the current study, it is possible the miR-378 regulation of FOXO3 may have mediated changes in MURF1 and Atrogin transcription at an earlier time point. [score:2]
There was an increase in miR-378 abundance in PRO from rest to 4 h (~40%, P < 0.05) and higher miR-378 with PRO above PLA at 4 h (~124%, P < 0.05, Figure 2B). [score:1]
Figure 2(A) mir-181-5p, (B) miR-378-5p, (C) miR-486-5p, and (D) miR-494-3p abundance at rest and at 4 h post-exercise recovery following a concurrent exercise session of resistance (8 sets of 5 leg extension at 80% 1-RM) and endurance (30 min cycling at 70% VO [2peak]) exercise and ingestion of either 500-mL PLA or PRO beverage immediately after exercise. [score:1]
[1 to 20 of 8 sentences]
23
[+] score: 23
Of those 70 miRNAs up- or down-regulated during adipocyte differentiation, 2 of the most significantly over-expressed (miR-30c and miR-378) and 4 of the most down-regulated (miR-210, miR-221, miR-424 and miR-503) were selected for validation by semi-quantitative Real Time-PCR. [score:9]
Thus, FAS, ACC, FABP4, PPARg, ADIPOQ and RBP4 gene expression levels were significantly and directly correlated with miR-30c and miR-378 but significantly and inversely related with miR-210, miR-221, miR-503 and miR-424 expression levels in RNA samples from cell lines [Figure S2]. [score:6]
On the other side, miR-378 (6.6-fold), miR-30c (5.1-fold), miR-30a (4.0-fold), miR-30b (3.1-fold), miR-30e (3.1-fold), miR-30a* (2.8-fold) and miR-34a (2.5-fold), were up-regulated in mature adipocytes (Figure 2). [score:4]
The miRNA expression levels were assessed by RT-PCR for miR-210 (MIMAT 0000267), miR-221 (MIMAT 0000278), miR-503 (MIMAT 0002874), miR-424 (MIMA 0001341), miR-378 (MIMAT 0000732), and miR-30c (MIMAT 0000244). [score:3]
It should be noted that, while 3 of these miRNAs (miR-30c, miR-210 and miR-221) have been previously described as obesity and/or adipogenesis-related [11], [26], the 3 others (miR-503, miR-378 and miR-424) were not. [score:1]
[1 to 20 of 5 sentences]
24
[+] score: 22
Following 24 h PhIP treatment, no change in miR378 expression was observed (Fig.   3b), whereas a dose -dependent upregulation of STAT3 mRNA expression was seen (Fig.   3b). [score:8]
To examine the roles of these mediators, we looked at the expression of miR378 and STAT3 mRNA in PhIP -treated MCF-7 cells (PhIP increased CYP2E1 expression). [score:5]
This implies that miR378 has no role in PhIP -mediated CYP2E1 upregulation in MCF-7 cells. [score:4]
Others have reported that miR378 can regulate CYP2E1 via translational repression (Mohri et al. 2010). [score:4]
The involvement of miR378 and JAK/STAT3 pathway in MCF-7 cells treated with different concentrations of PhIP was assessed by qPCR (b). [score:1]
[1 to 20 of 5 sentences]
25
[+] score: 22
In addition to GRB2, miR-378 directly targeted three additional components of the RAS-MAPK pathway: Mitogen-activated protein kinase 1 (MAPK1, alias ERK2), insulin-like growth factor receptor 1 (IGF1R), and kinase suppressor of RAS 1 (KSR1) [40]. [score:6]
MiR-433 and miR-378 down-regulation in cancer could hence represent an oncogenic event leading to an aberrant activation of the RAS-MAPK pathway by enhancing GRB2 activity. [score:4]
MiR-378 overexpression could repress cardiomyocytes proliferation and subsequent cardiac hypertrophy by suppressing the RAS-MAPK signaling pathway [39]. [score:4]
Demonstration has come originally from the observation that miR-378 is strongly overexpressed in cardiomyocytes. [score:3]
MiR-378 was found down-regulated in various types of cancers such as prostate [41] and gastric cancers [42]. [score:3]
MiR-378 has also been demonstrated to target GRB2. [score:2]
[1 to 20 of 6 sentences]
26
[+] score: 21
Statistical significance enrichment analysis identified nine miRNAs as frequently targeted at detected spliced transcripts: hsa-miR-769-3p (predicted to target four transcripts), hsa-miR-378 (with six targets) as well as hsa-mir-320, hsa-miR-92b-5p, hsa-miR-16, hsa-miR-150, hsa-miR-671, hsa-miR-20a, and hsa-miR-18b (The full list and adjusted p-values are given under Table S10). [score:7]
For example, hsa-mir-20a and hsa-miR-378 increased in PD patients and decreased post-DBS, whereas the inflammatory -regulating hsa-miR-424 (Spinelli et al., 2013) showed no change in PD but it's passenger 3′ form (hsa-miR-18b-3p, previously called star form) exhibited down-regulation following DBS. [score:5]
Of these, hsa-miR-378, and hsa-miR-20a were predicted to bind the same seven AS target genes, affecting the actin -associated protein VASP involved in axon guidance (Mohamed et al., 2012), the hemoglobin subunit gamma-2 HBG2 gene, the retinoic acid receptor responder RARRES3, the androgen-regulated solute carrier SLC14A1 (Vaarala et al., 2012), TMEM69, a dividing leukocytes biomarker (Solmi et al., 2006), the mitochondrial tRNA dimethyl-allyltransferase trit1 and the bZIP nuclear transcription factor. [score:4]
Also, the reduced hsa-miR-378 (log fold change: 2.25, p-value: 0.000109) predicts impaired control over mitochondrial metabolism (Carrer et al., 2012) and negatively regulated NK cell cytotoxicity (Wang et al., 2012). [score:2]
Identification of resting and type I IFN-activated human NK cell miRNomes reveals MicroRNA-378 and MicroRNA-30e as negative regulators of NK cell cytotoxicity. [score:2]
Enrichment analysis detected 6 of the DBS -modified miRNAs as modified (having adjusted p-value < 0.05): hsa-miR-320 (a, b, and c) as predicted to bind 4 spliced transcripts including hnRNPA2B1, hsa-miR-378 (predicted to bind 6 spliced transcripts), hsa-miR-92b (predicted to bind 4 spliced transcripts), hsa-mir-150, hsa-miR-20a, and hsa-miR-18b (where hsa-miR-18b-3′ changed). [score:1]
[1 to 20 of 6 sentences]
27
[+] score: 21
Several examples are: miR-17-92 which is upregulated in colonocytes coexpressing K-Ras and c-Myc, represses the expression of anti-angiogenic thrombospondin-1 (Tsp1) and connective tissue growth factor (CTGF), thus induces angiogenesis [17]; miR-378 promotes angiogenesis induced by human glioblastoma cell line U87 by targeting Fus-1 expression [18]; miR-126 regulates vascular integrity and angiogenesis, and miR-126 restoration decreases VEGF level in lung cancer cells [19], [20]; miR-130a mediates angiogenesis through downregulating antiangiogenic homeobox genes GAX and HOXA5 [21]; miR-296 level is elevated in primary brain tumor endothelial cells and regulates angiogenesis by directly targeting the hepatocyte growth factor-regulated tyrosine kinase substrate mRNA, leading to the reduction of HGS -mediated degradation of the growth factor receptors VEGFR2 and PDGFRbeta [22]. [score:21]
[1 to 20 of 1 sentences]
28
[+] score: 20
Based on the case that miR-378 and miR-214 were up-regulated in the blood serum of cancer patients (Table 8) and down-regulated in the tumor tissues; therefore, it can be concluded that they can function as upregulated oncomiRs miRNAs on subunits of the TCR-CD3 complex. [score:10]
miR-378, miR-422a, miR-593 and miR-494 from the first group, which affected the CD3G gene (responsible for the CD3-gamma subunit), and were down-regulated in cancer tissues, when compared to adjacent normal tissues (Table 5), whereas miR-378 was up-regulated in blood sera of cancer patients (Table 8). [score:6]
Since miR-378, miR-422a, miR-593, miR-494, miR-138 and miR-214 could target the CD3 subunits, some of which have been studied in different cancers and have been considered as biomarkers to detect cancer at the early stages, it is then highly likely that miRNAs damage the immune system so that it cannot distinguish cancer cells. [score:2]
From the first group only 6 miRNAs (miR-378, miR-422a, miR-593 and miR-494, miR-515 and miR-136), from the second group one miRNA (miR-138) and from the third group only one miRNA (miR-214) were identified and studied, based on their levels in tissues or blood sera of different cancer patients. [score:1]
The results showed that has-miR-378, which was a miRNA predicted for CD3G, had increased in all blood sera belonging to patients suffering from castration resistant prostate cancer (CRPC) [38], renal cell carcinoma (RCC) [16], [39] and gastric cancer (GC) [40]; besides, cancer tissues in patients with bladder cancer (BC) [41], carcinoma basal cells [42], colorectal cancer (CRC) [43], oral carcinoma [44], laryngeal carcinoma [45] and gastric cancer [46]. [score:1]
[1 to 20 of 5 sentences]
29
[+] score: 19
MiR-378 could inhibit tumor growth and invasion partly by targeting vimentin in colorectal cancer [39]. [score:4]
Interestingly, miRNA-378 family (-i;-f;-e;-g;-*) members are represented highly in downregulated groups of miRNAs. [score:4]
The continuous downregulation observed in adenoma-carcinoma samples in case of miR-375, miR-378, miR-139-5p, miR-133a, and miR-422a was confirmed by others [36– 44]. [score:4]
Eight (without miR-378 variants) downregulated miRNAs showed approx. [score:4]
Interestingly, members of miR-378 family were highly represented in this comparison, as well as in the groups with continuously changing expression in adenoma to carcinoma progression. [score:3]
[1 to 20 of 5 sentences]
30
[+] score: 19
In TM4 cells exposed to NP, Ppara was down-regulated at both 3 and 24 h. We thus surmised that miRNAs regulated by Ppara may include miR-378, miR-125a-3p, and miRNA-148a at 3 h, and miR-20a, miR-203, and miR-101a at 24 h. Figure 3 Network analysis of miRNAs the expression of which in TM4 cells was altered by NP (A) 3 h. (B) 24 h. Network analysis was performed using an algorithm supported by IPA. [score:7]
In TM4 cells exposed to NP, Ppara was down-regulated at both 3 and 24 h. We thus surmised that miRNAs regulated by Ppara may include miR-378, miR-125a-3p, and miRNA-148a at 3 h, and miR-20a, miR-203, and miR-101a at 24 h. Figure 3 Network analysis of miRNAs the expression of which in TM4 cells was altered by NP (A) 3 h. (B) 24 h. Network analysis was performed using an algorithm supported by IPA. [score:7]
Network analysis of deregulated miRNAs suggested that Ppara may regulate the expression of certain miRNAs, including miR-378, miR-125a-3p miR-20a, miR-203, and miR-101a, after exposure to NP. [score:5]
[1 to 20 of 3 sentences]
31
[+] score: 18
Lee et al. (2007) have found that miR-378 promotes angiogenesis by targeting SuFu and Fus-1 expression 59; these findings are consistent with the present results showing lower expression of SuFu and Fus-1 in PMM (Fig. 6d). [score:7]
Interestingly, miR-378 was the second highest expressed miRNA both in LDM and PMM, but had lower methylation levels and higher expression levels in PMM. [score:5]
Additionally, the expression of miR-378, mediated by its promoter methylation status, has also been verified in cell levels 60. [score:3]
Previous studies have reported that miR-378 regulates mitochondrial metabolism, systemic energy homeostasis and myoblast differentiation 57 58. [score:2]
However, between LDM and PMM, there were only five miRNAs that exhibited different methylation levels in their promoter regions, including miR-378, miR-181c, miR-181d, miR-139 and miR-216 (Supplementary Table S5). [score:1]
[1 to 20 of 5 sentences]
32
[+] score: 17
No change was observed for miR-30c-2-3p and expression of miR-340-5p and miR-378b were increased (Fig.   2d), again indicating that the altered expression of these miRNAs is not a reproducible hallmark of mutant p53 expression in isolated tumour-derived cells. [score:7]
Statistical significance is represented as * p < 0.05, ** p < 0.01 and *** p < 0.005 Table 1 ▓▓▓▓ microRNA FDR FC Pten [flox] vs p53 [R172H] FC p53 [flox] vs p53 [R172H] mmu-miR-142-3p 0.015912686 −3.7405517 −4.579501 mmu-miR-30c-2-3p 0.046220515 −15.577352 −10.701015 mmu-miR-340-5p 0.03768438 −1.9938585 −2.1791608 mmu-miR-378b 0.04617887 −2.1360645 −1.9538167This analysis provides information about miRNA expression changes in the physiological context of the primary tumour environment in mouse mo dels. [score:3]
Statistical significance is represented as * p < 0.05, ** p < 0.01 and *** p < 0.005 Table 1 ▓▓▓▓ microRNA FDR FC Pten [flox] vs p53 [R172H] FC p53 [flox] vs p53 [R172H] mmu-miR-142-3p 0.015912686 −3.7405517 −4.579501 mmu-miR-30c-2-3p 0.046220515 −15.577352 −10.701015 mmu-miR-340-5p 0.03768438 −1.9938585 −2.1791608 mmu-miR-378b 0.04617887 −2.1360645 −1.9538167 This analysis provides information about miRNA expression changes in the physiological context of the primary tumour environment in mouse mo dels. [score:3]
Expression of miR-30c-2-3p and miR-378b was found to be significant between Kras Pten [flox] and Kras p53 [R172H] but not between Kras Pten [flox] and Kras p53 [R172H] (Fig.   1c). [score:3]
A total of four miRNAs, miR-142-3p, miR-30c-2-3p, miR-340-5p and miR-378b, were found to be dysregulated in the Kras p53 [R172H] tissues compared to both the Kras p53 [flox] and Kras Pten [flox] tissues. [score:1]
[1 to 20 of 5 sentences]
33
[+] score: 17
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-148a, hsa-mir-10a, hsa-mir-181a-2, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-181a-1, hsa-mir-214, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-23b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-206, hsa-mir-1-1, hsa-mir-128-2, hsa-mir-29c, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-148b, hsa-mir-133b, hsa-mir-424, ssc-mir-125b-2, ssc-mir-148a, ssc-mir-23a, ssc-mir-24-1, ssc-mir-26a, ssc-mir-29b-1, ssc-mir-181c, ssc-mir-214, ssc-mir-27a, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-128-1, ssc-mir-29c, hsa-mir-486-1, hsa-mir-499a, hsa-mir-503, hsa-mir-411, hsa-mir-378d-2, hsa-mir-208b, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-17, ssc-mir-221, ssc-mir-133a-1, ssc-mir-1, ssc-mir-503, ssc-mir-181a-1, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-29a, ssc-mir-199a-2, ssc-mir-128-2, ssc-mir-499, ssc-mir-143, ssc-mir-10a, ssc-mir-486-1, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-23b, ssc-mir-148b, ssc-mir-208b, ssc-mir-424, ssc-mir-127, ssc-mir-125b-1, hsa-mir-378c, ssc-mir-411, ssc-mir-133a-2, ssc-mir-126, ssc-mir-199a-1, ssc-mir-378-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-499b, ssc-let-7a-2, ssc-mir-486-2, hsa-mir-378j, ssc-let-7d, ssc-let-7f-2, ssc-mir-29b-2, hsa-mir-486-2, ssc-mir-378b
Interestingly, recently studies have validated that ssc-miR-378 regulated myogenesis by directly targeting the BMP2 or MAPK1 in pig, suggesting that the STEM clustering was reliable for analyzing miRNA expression profiles as well as for predicting of candidate myogenic miRNAs. [score:7]
STEM clustering results suggested that ssc-miR-378 functioned as a new candidate miRNA for porcine myogenesis because of its expression profile similar to ssc-miR-1 and -133a-3p (Figure 5A). [score:3]
Similarly, two other myomiRs, miR-133 [21] and miR-206 [23], were highly expressed and ranked the 4 [th] and 6 [th] respectively, while two other miRNAs (miR-378 [24, 25] and miR-143 [25]) ranked the 2 [nd] and 3 [rd] have been identified to participate in the proliferation and differentiation of muscle cells. [score:3]
Interestingly, the second abundant DE miRNA was miR-378, a new candidate miRNA for myogenesis in pigs by down -regulating porcine BMP2 or MAPK1 [53]. [score:2]
Consequently, 18 candidate miRNAs were selected, including ssc-miR-378, -127, -128, -411, 23b, -27b, -10a, -140*, -9-1/-2, -148a/b, -126, 542-3p, 30a-5p/d/e-5p and miR-103 (Figure 5). [score:1]
In addition to the best-studied myomiRs (miR-1, -206 and miR-133 families), 11 other DE muscle-related miRNAs (miR-378 [24], miR-148a [27], miR-26a [28, 29], miR-27a/b [30, 31], miR-23a [32, 33], miR-125b [34], miR-24 [35], miR-128 [36], miR-199a [37] and miR-424 [38]) with high abundance (average RPM >1,000) and another 14 (miR-181a/b/c/d-5p [26], miR-499-5p [11], miR-503 [38], miR-486 [39], miR-214 [40], miR-29a/b/c [41– 43], miR-221/222 [44] and miR-208 [11] with low abundance (average RPM <1,000) were detected in myogenesis of pig. [score:1]
[1 to 20 of 6 sentences]
34
[+] score: 17
Other miRNAs from this paper: hsa-mir-25, hsa-mir-28, hsa-mir-95, mmu-mir-151, mmu-mir-290a, mmu-mir-297a-1, mmu-mir-297a-2, mmu-mir-130b, mmu-mir-340, mmu-mir-25, mmu-mir-28a, hsa-mir-130b, hsa-mir-367, hsa-mir-372, hsa-mir-378a, mmu-mir-378a, hsa-mir-340, hsa-mir-151a, mmu-mir-466a, mmu-mir-467a-1, hsa-mir-505, hsa-mir-506, mmu-mir-367, hsa-mir-92b, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-648, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-659, hsa-mir-421, hsa-mir-151b, hsa-mir-1271, hsa-mir-378d-2, mmu-mir-467b, mmu-mir-297b, mmu-mir-505, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-297c, mmu-mir-421, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-467c, mmu-mir-467d, mmu-mir-92b, mmu-mir-466d, hsa-mir-297, mmu-mir-467e, mmu-mir-466l, mmu-mir-669g, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-467f, mmu-mir-466j, mmu-mir-467g, mmu-mir-467h, mmu-mir-1195, hsa-mir-548e, hsa-mir-548j, hsa-mir-1285-1, hsa-mir-1285-2, hsa-mir-1289-1, hsa-mir-1289-2, hsa-mir-548k, hsa-mir-1299, hsa-mir-548l, hsa-mir-1302-1, hsa-mir-1302-2, hsa-mir-1302-3, hsa-mir-1302-4, hsa-mir-1302-5, hsa-mir-1302-6, hsa-mir-1302-7, hsa-mir-1302-8, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-1255a, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-1268a, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-1255b-1, hsa-mir-1255b-2, mmu-mir-1906-1, hsa-mir-1972-1, hsa-mir-548q, mmu-mir-466m, mmu-mir-466o, mmu-mir-467a-2, mmu-mir-467a-3, mmu-mir-466c-2, mmu-mir-467a-4, mmu-mir-466b-4, mmu-mir-467a-5, mmu-mir-466b-5, mmu-mir-467a-6, mmu-mir-466b-6, mmu-mir-467a-7, mmu-mir-466b-7, mmu-mir-467a-8, mmu-mir-467a-9, mmu-mir-467a-10, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, hsa-mir-3116-1, hsa-mir-3116-2, hsa-mir-3118-1, hsa-mir-3118-2, hsa-mir-3118-3, hsa-mir-548s, hsa-mir-466, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-3156-1, hsa-mir-3118-4, hsa-mir-3174, hsa-mir-3179-1, hsa-mir-3179-2, hsa-mir-3179-3, hsa-mir-548w, hsa-mir-3156-2, hsa-mir-3156-3, hsa-mir-548x, mmu-mir-3470a, mmu-mir-3470b, mmu-mir-3471-1, mmu-mir-3471-2, hsa-mir-378c, hsa-mir-1972-2, hsa-mir-1302-9, hsa-mir-1302-10, hsa-mir-1302-11, mmu-mir-1906-2, hsa-mir-3683, hsa-mir-3690-1, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-1268b, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, mmu-mir-28c, mmu-mir-378b, mmu-mir-28b, hsa-mir-548ao, hsa-mir-548ap, mmu-mir-466q, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, mmu-mir-378c, mmu-mir-378d, hsa-mir-548ay, hsa-mir-548az, hsa-mir-3690-2, mmu-mir-290b, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-3179-4, mmu-mir-466c-3, hsa-mir-548bc, mmu-mir-1271
In the miR-378 network (Figure 8A), ERBB2 is a transcription factor of the miR-378 gene and it's host gene PPARGC1B which encodes PGC-1β [73] and HNE, which it also appears, could downregulate miR-378 and induce the expression of its target gene, SuFu [74]. [score:8]
The expression of miR-378* increases during breast cancer progression and miR-378* induces the Warburg effect in breast cancer cells by inhibiting the expression of two PGC-1 partners, ERR and GABPA [73]. [score:7]
0017666.g008 Figure 8 (A) miR-378 (RdmiR, mir-378 family). [score:1]
The functional networks of miR-92b (PRdmiR, mir-25 family, derived from GC rich tandem repeats), miR-28 (RdmiR, mir-28 family, derived from LINE), miR-151 (RdmiR, mir-28 family, derived from LINE), miR-421 (RdmiR, mir-95 family, derived from LINE), miR-1271 (RdmiR, mir-1271 family, derived from LINE), miR-340 (RdmiR, mir-340 family, derived from DNA transportable element) and miR-378 (RdmiR, mir-378 family, derived from SINE) have been reconstructed (Figure 8). [score:1]
[1 to 20 of 4 sentences]
35
[+] score: 17
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-31, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-30c-2, hsa-mir-147a, hsa-mir-10a, hsa-mir-34a, hsa-mir-181b-1, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-204, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-193a, hsa-mir-195, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-30c-1, hsa-mir-219a-2, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-302d, hsa-mir-374a, hsa-mir-375, hsa-mir-378a, hsa-mir-330, hsa-mir-328, hsa-mir-342, hsa-mir-325, hsa-mir-424, hsa-mir-429, hsa-mir-450a-1, hsa-mir-486-1, hsa-mir-146b, hsa-mir-497, hsa-mir-520e, hsa-mir-520f, hsa-mir-520a, hsa-mir-520b, hsa-mir-520c, hsa-mir-520d, hsa-mir-520g, hsa-mir-520h, hsa-mir-450a-2, hsa-mir-503, hsa-mir-608, hsa-mir-625, hsa-mir-629, hsa-mir-663a, hsa-mir-1271, hsa-mir-769, hsa-mir-378d-2, hsa-mir-675, hsa-mir-147b, hsa-mir-374b, hsa-mir-663b, hsa-mir-378c, hsa-mir-374c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-4661, hsa-mir-219b, hsa-mir-203b, hsa-mir-378j, hsa-mir-486-2
Adiponectin expression in 3T3-L1 cells, an anti-inflammatory adipokine, can be modulated by miR-378 via the 3´UTR sequence -binding site since the expression levels of adiponectin and mirR-378 were negatively well correlated in these cells after being treated with TNFα [63]. [score:5]
Xu L. L. Shi C. M. Xu G. F. Chen L. Zhu L. L. Zhu L. Guo X. R. Xu M. Y. Ji C. B. TNF-α, IL-6, and leptin increase the expression of miR-378, an adipogenesis-related microRNA in human adipocytesCell Biochem. [score:3]
Expression of miR-378 was found to be significantly elevated after TNF-α, IL-6, and leptin stimulation, whose result indicates that miR-378 probably is a novel mediator in the molecular mechanisms related to insulin resistance and obesity. [score:3]
Ishida M. Shimabukuro M. Yagi S. Nishimoto S. Kozuka C. Fukuda D. Soeki T. Masuzaki H. Tsutsui M. Sata M. MicroRNA-378 regulates adiponectin expression in adipose tissue: A new plausible mechanismPLoS ONE 2014 e111537 10.1371/journal. [score:3]
Another miR that seems to be involved in some inflammatory process is the miR-378. [score:1]
Xu et al. [61] evaluated the expression of miR-378 in human pre-adipocytes cells that were induced to differentiation. [score:1]
Also, miR-378 has important roles in adipogenesis. [score:1]
[1 to 20 of 7 sentences]
36
[+] score: 16
In accordance with our results, miR-21, miR-100, and miR-125b were upregulated, whereas miR-455-3p and miR-378 were downregulated in chemoresistant BxPC-3. In addition, miR-330-5p could be detected by Tréhoux et al. as a tumor suppressor in PDAC in vitro and in vivo, sensitizing pancreatic cancer cells to gemcitabine [19]. [score:9]
MiR-screening revealed significantly upregulated (miR-21, miR-99a, miR-100, miR-125b, miR-138, miR-210) and downregulated miRs (miR-31*, miR-330, miR-378) in chemoresistant PDAC (p<0.05). [score:7]
[1 to 20 of 2 sentences]
37
[+] score: 16
For example, downregulation of miRNAs, such as miR-145, -195, -383 and miR-378, was found in CRC relative to their expressions in normal mucosa, whereas, some upregulated miRNAs, like miR-96, -135b, miR-493 and miR-133a, have also been found associated with CRC [19], [20]. [score:9]
Among the downregulated, miR-145* had the highest fold change (23.8-fold), while others that were downregulated more than 5-fold included miR-145, -101*, -133a, -214, -4768-3p, -4770, let-7e, miR-378*, -99a, -193b, -100, and -1185. [score:7]
[1 to 20 of 2 sentences]
38
[+] score: 15
Caspase-3 is a target protein of miR-378, and over -expression of this miRNA has been shown to inhibit apoptosis, whereas inhibition of miR-378 aggravates hypoxia -induced apoptosis [35]. [score:9]
A further down-regulated miRNA in response to IR was miR-378. [score:4]
In this experimental setting miRNA-378 was notably reduced in irradiated cells. [score:1]
Caspase-3 activity has been shown to be controlled by miRNA-378 [35]. [score:1]
[1 to 20 of 4 sentences]
39
[+] score: 15
In basal conditions (day 0), up-regulated miRNAs were: miR-1225-3p, miR-1305, miR-1238, miR-425, miR-191* and miR-34a, while miR-378 was the only down-regulated miR. [score:7]
Five miRs have one single target gene (miR-202: CBFA2T3, miR-500: NEBL, miR-378: KIF26A, miR-892b: BACH2, miR-1305:ID1), with a restricted impact on gene expression modulation. [score:5]
Several microRNAs seem to regulate multiple genes of the TGFbeta pathway, like miR-760: SMAD4/SMURF1, miR-378: SMAD2/SMAD4/SOS1, miR-26b: SMAD2/4, miR-520e: AKT1/SMAD4. [score:2]
In parallel, we observed the modulation of several cancer-related microRNAs like miR-34a, miR-26b or miR-378. [score:1]
[1 to 20 of 4 sentences]
40
[+] score: 14
These include the miR-130 family members that repress brown and white adipogenesis via direct inhibition of Pparg [30] and miR-378 that activates Cebpa and Cebpb expression during adipogenesis and enhances brown fat expansion [31, 32]. [score:6]
In concert with this, the expression of miR-378 was at the same level in Fto- KO BAT of mice fed either diet while in the WT BAT, miR-378 was decreased by 1.4-fold after HFD. [score:3]
Gerin I. Bommer G. T. McCoin C. S. Sousa K. M. Krishnan V. MacDougald O. A. Roles for miRNA-378/378* in Adipocyte Gene Expression and Lipogenesis Am. [score:3]
In addition, miR-378 was reported to activate C/EBPs during adipogenesis and enhance BAT expansion [31, 35]. [score:1]
miR-378 has been shown to activate Cebpa and Pparg [31, 35]. [score:1]
[1 to 20 of 5 sentences]
41
[+] score: 14
B. qPCR showing relative expression of miR-378 and Igf1r, validated miR-378 target gene, following miR-378 overexpression or inhibition in human primary myoblasts. [score:9]
A. MF20 (myosin heavy chain) immunostaining of differentiated primary myotubes from adult humans showing the effects of overexpression or inhibition of miR-378 on myotube size and number. [score:5]
[1 to 20 of 2 sentences]
42
[+] score: 14
Two targets of miR-378-5p as predicted by Targetscan 5.2 [29], SP1 and SUFU, previously have been implicated in regulation of p16 [INK4A] [30], [31]. [score:6]
Our screen identified several miRNAs that can regulate senescence, among which miR-378a-5p (previously miR-378 and miR-378*), a miRNA that is expressed in several types of cancer and has oncogenic properties [19]– [23]. [score:4]
Identification of potential miR-378-5p target mRNAs. [score:3]
TIG3-hTERT-ΔBraf:ER cells were transfected with scrambled control or miR-378-5p oligonucleotides. [score:1]
[1 to 20 of 4 sentences]
43
[+] score: 13
Deep Sequencing the microRNA profile in rhabdomyosarcoma reveals down-regulation of miR-378 family members. [score:4]
A novel cardiomyocyte-enriched microRNA, miR-378, targets insulin-like growth factor 1 receptor. [score:3]
Figure 6 The phylogenetic tree of the members of the miR-378 family. [score:1]
The sequence similarities of novel_3-3p to the members of the miR-378 family strongly suggest that we found a new microRNA of this family. [score:1]
The BLAST results revealed a high similarity of novel_3-3p to the sequences of the miR-378 family. [score:1]
Figure 7 Alignment of the novel microRNAs (A) novel_3-3p with the members of the miR-378 family and (B) novel_4-5p with miR-1260a/b. [score:1]
Therefore, we performed a multiple sequence alignment using ClustalW to determine which of the miR-378 microRNAs is most closely related to novel_3-3p. [score:1]
The microRNAs of the miR-378 family play a role in rhabdomyosarcoma, myogenesis, and apoptosis (Knezevic et al., 2012; Megiorni et al., 2014). [score:1]
[1 to 20 of 8 sentences]
44
[+] score: 13
Among genes involved in cell proliferation, the transcription factor NKX3-1 (2.4-fold upregulated), which mediates non-cell autonomous regulation of gene expression and inhibits cell proliferation, is correlated with miR-9-3p, miR-155-5p, miR-378a-3p, and miR-378-5p (Figure 5). [score:9]
miR-378 (actually annotated as miR-378a) is significantly downregulated in colorectal cancer [74], in cutaneous squamous cell carcinoma [75], and in renal cell carcinoma [76]. [score:4]
[1 to 20 of 2 sentences]
45
[+] score: 13
In addition, several researchers found that MAPK1 could serve as potential target gene for miRNAs and miR-378 inhibited prostate cancer cell growth through targeting MAPK1 [28]. [score:7]
Chen et al. revealed that miR-378 suppressed prostate cancer cell growth through down-regulation of MAPK1 in vitro and in vivo. [score:6]
[1 to 20 of 2 sentences]
46
[+] score: 13
miR-196a, miR-486-5p, miR-664-star, and miR-378-star were upregulated, and miR-10a, miR-708, and miR-3197 were downregulated in old versus young hMSCs. [score:7]
Notably, miR-196a, miR-486-5p, miR-664-star, and miR-378-star were all significantly upregulated, and miR-10a, miR-708, and miR-3197 were downregulated in the hMSCs from old subjects compared with young subjects (Fig. 2B). [score:6]
[1 to 20 of 2 sentences]
47
[+] score: 13
Therefore, Deng et al (66) inferred that CDK6 may be the potential target gene of miR-195 in GC and that VEGF may be a candidate target gene of miR-378. [score:5]
CDK6 as a direct target of miR-195 in hepatocellular carcinoma cells has been reported and the 3′UTR of vascular endothelial growth factor (VEGF) has been demonstrated to contain a potential binding site for miR-378 (67, 68). [score:4]
The G0/G1 phase arrest caused by miR-195 may be due to the suppression of CDK6, but the mechanism of G2/M phase arrest caused by miR-378 is not clear. [score:3]
miR-195 and miR-378. [score:1]
[1 to 20 of 4 sentences]
48
[+] score: 13
For example, hsa-miR-382, hsa-miR-31, and hsa-miR-149 are downregulated in medulloblastoma [51], hsa-miR-378 is downregulated in Alzheimer’s disease [52], and abnormal expression of hsa-miR-218 has been detected in samples from Parkinson’s disease patients [53]. [score:13]
[1 to 20 of 1 sentences]
49
[+] score: 12
These results demonstrate that downregulation of hsa-miR-378-5p promotes CRC cell growth by targeting BRAF and that restoration of their levels is a potentially promising therapeutic in CRC [29]. [score:6]
Previous reports using Western blot and quantitative RT-PCR analysis indicated that BRAF was downregulated by hsa-miR-378-5p in CRC cells [29]. [score:4]
In a literature review, Clancy et al. determined six circulating miRNAs, hsa-miR-18a-5p, hsa-miR-21-5p, hsa-miR-29a-5p, hsa-miR-92a-5p, hsa-miR-143-5p and hsa-miR-378-5p, which were most frequently found to be dysregulated in colorectal cancer. [score:2]
[1 to 20 of 3 sentences]
50
[+] score: 12
For the miRNAs unique to one cell type, miR-378 was found to be 4 fold up-regulated in monocytes relative to T cells, the cell type in which miR-378 had the second highest expression level (p*<0.04). [score:6]
Four small -RNA transcripts were each found to be expressed specifically in one cell type: miR-378 in monocytes, miR-31 in T cells, miR-935 in eosinophils and miR-143 in neutrophils (Figure 1). [score:3]
Little is known regarding the function of miR-378 in monocytes, or miR-935 in eosinophils. [score:1]
We identified miR-143 as neutrophil specific, miR-31 as T-cell specific, miR-378 as monocyte specific and miR-935 as eosinophil specific. [score:1]
All miRNAs reported as specific to single cell types in the Roche dataset (miR-143, miR-31, miR-935 and miR-378) remained significant in the HUG dataset, while additional miRNAs were found to be cell-type specific, most notably miR-145 in neutrophils, miR-181 in NK cells and miR-146 in T cells and NK cells. [score:1]
[1 to 20 of 5 sentences]
51
[+] score: 12
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-98, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-30b, hsa-mir-130a, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-185, hsa-mir-193a, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-181b-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-363, hsa-mir-374a, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-423, hsa-mir-20b, hsa-mir-491, hsa-mir-193b, hsa-mir-181d, hsa-mir-92b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, bta-mir-29a, bta-let-7f-2, bta-mir-148a, bta-mir-18a, bta-mir-20a, bta-mir-221, bta-mir-27a, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-30b, bta-mir-106a, bta-mir-10a, bta-mir-15b, bta-mir-181b-2, bta-mir-193a, bta-mir-20b, bta-mir-30e, bta-mir-92a-2, bta-mir-98, bta-let-7d, bta-mir-148b, bta-mir-17, bta-mir-181c, bta-mir-191, bta-mir-200c, bta-mir-22, bta-mir-29b-2, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-25, bta-mir-363, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-15a, bta-mir-19a, bta-mir-19b, bta-mir-331, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, bta-mir-1-2, bta-mir-1-1, bta-mir-130a, bta-mir-130b, bta-mir-152, bta-mir-181d, bta-mir-182, bta-mir-185, bta-mir-24-1, bta-mir-193b, bta-mir-29d, bta-mir-30f, bta-mir-339a, bta-mir-374b, bta-mir-375, bta-mir-378-1, bta-mir-491, bta-mir-92a-1, bta-mir-92b, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, bta-mir-320b, bta-mir-339b, bta-mir-19b-2, bta-mir-320a-1, bta-mir-193a-2, bta-mir-378-2, hsa-mir-320e, hsa-mir-378c, bta-mir-148c, hsa-mir-374c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-378j, bta-mir-378b, bta-mir-378c, bta-mir-378d, bta-mir-374c, bta-mir-148d
MiR-378 promotes osteoblast differentiation by targeting polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7 or GalNT7) [70], and miR-191 regulates erythroid differentiation in mammals by up -regulating erythroid-enriched genes Riok3 and Mxi1[71]. [score:5]
Let-7a, let-7c, miR-181b, miR-185, miR-378 and miR-423-5p were predicted to target the inducible co-stimulatory molecule (ICOS), which plays a key role in regulating T-cell differentiation, T-cell proliferation, and secretion of lymphokines, providing effective help for antibody secretion by B cells [86]. [score:4]
Notably, some miRNAs among the top 10 identified here have been reported to be related to immunity (miR-320, miR-181a, miR-30a-3p, let-7a, let-7f and let-7c) and development (miR-193a-3p, miR-378 and miR-191). [score:2]
The top 10 miRNAs were ssc-miR-193a-3p, ssc-miR-423-5p, ssc-miR-320, ssc-miR-181a, ssc-miR-30a-3p, ssc-miR-378, ssc-miR-191, ssc-let-7a, ssc-let-7f and ssc-let-7c. [score:1]
[1 to 20 of 4 sentences]
52
[+] score: 12
Fig.  5Expression of selected (involved in the MDM differentiation process) microRNAs in MDM + TMV0d and MDM + TMV6d vs control MDM (black line at level 1) presented as relative expression normalized to U6 (2 [−ΔΔCT]): miR-155 (a), miR-378 (b), miR-9 (c), miR-21 (d), miR-511 (e). [score:5]
Upregulation of miR-378 was detected only in MDM + TMV [LoVo]6d and MDM + TMV [SW480]6d in comparison to MDM + TMV0d (Fig.   5b). [score:4]
MDM + TMV [LoVo]6d and MDM + TMV [SW480]6d expressed also more miR-378. [score:3]
[1 to 20 of 3 sentences]
53
[+] score: 12
In addition, miR-378, which was downregulated by 36.78-fold in the present study, has been previously reported to promote cell survival, tumor growth and angiogenesis through targeting suppressor of fused and fused in sarcoma-1 (25). [score:8]
Together, miR-146b-5p and miR-378 are known to be critical miRNAs involved in cell survival and anti-senescence; thus, regulation of their expression is a promising strategy for the treatment of PPD -mediated cellular senescence in dermal papilla cells. [score:4]
[1 to 20 of 2 sentences]
54
[+] score: 11
Then, for instance, miR-378, which is down-regulated in malignant ovarian tissue, could be induced to over express to a normal level, possibly making the cells more sensitive to platinum -based chemotherapy. [score:6]
It was established that increased expression of miR-23a, miR-27a, miR-30c, let-7g, and miR-199a-3p corresponds to resistance to platinum -based chemotherapy while reduced expression of miR-378 and miR-625 relates to resistance. [score:5]
[1 to 20 of 2 sentences]
55
[+] score: 11
These findings suggest miR-378 inhibitors could potentially suppress differentiation of both multi-potent MSCs and pre-adipocytes and hence reduce the pool of mature lipid storing adipocytes. [score:5]
Further work in the ST2 mesenchymal cell-line demonstrated overexpression of miR-378/378* could increase lipid droplet size independently of C/EBP isoforms and PPARγ1 which are known to stimulate increases in lipid droplet size [56]. [score:3]
Conversely, knockdown of miR-378/278* decreased triglyceride accumulation [56]. [score:2]
Interestingly, miR-378/378* is encoded within the intron of PGC-1β and is highly induced during differentiation of mouse 3T3-L1 pre-adipocytes and mouse pre-adipocytes [56]. [score:1]
[1 to 20 of 4 sentences]
56
[+] score: 11
92) 43 hsa-mir-302a dbDEMC 19 hsa-let-7g dbDEMC, miR2Disease 44 hsa-mir-212 literature 20 hsa-let-7b dbDEMC, HMDD, miR2Disease 45 hsa-mir-372 dbDEMC 21 hsa-mir-150 dbDEMC, literature 46 hsa-mir-197 dbDEMC 22 hsa-mir-338 dbDEMC 47 hsa-mir-124 literature 23 hsa-mir-103 dbDEMC, miR2Disease 48 hsa-mir-378 HMDD 24 hsa-mir-15b dbDEMC, HMDD 49 hsa-mir-26b dbDEMC, miR2Disease 25 hsa-mir-31 dbDEMC, HMDD, miR2Disease 50 hsa-mir-542 higher RWRMDA (No. [score:11]
[1 to 20 of 1 sentences]
57
[+] score: 11
Adiponectin expression is negative correlated with the expression of miR-378 [28]. [score:5]
Gerin I Roles for miRNA-378/378* in adipocyte gene expression and lipogenesisAmerican journal of physiology. [score:3]
Interestingly, it has been shown that miR-378 targets insulin-like growth factor receptor [26] and is involved in lipid metabolism [27]. [score:3]
[1 to 20 of 3 sentences]
58
[+] score: 10
Among these dysregulated miRNAs, miR-378 was downregulated while miR-221 expression increased in aHSCs compared to qHSCs, consistent with previous reports 18, 19 and demonstrating the reliability of our microarray data. [score:6]
Hyun J MicroRNA-378 limits activation of hepatic stellate cells and liver fibrosis by suppressing Gli3 expressionNat. [score:4]
[1 to 20 of 2 sentences]
59
[+] score: 10
For instance, miR-378 inhibits insulin signaling by targeting p110α in hepatocytes of ob/ob mice [47], and miR-320 decreases insulin sensitivity in 3T3-L1 adipocytes by targeting the p85 unit of PI3K [48]. [score:7]
Liu W. Cao H. Ye C. Chang C. Lu M. Jing Y. Zhang D. Yao X. Duan Z. Xia H. Hepatic miR-378 targets p110α and controls glucose and lipid homeostasis by modulating hepatic insulin signalling Nat. [score:3]
[1 to 20 of 2 sentences]
60
[+] score: 10
We identified 3 significantly down-regulated miRNAs (miR-378-3p, miR-483-5p and miR-497-5p) and 1 up-regulated miRNA (miR-222-3p) (Figure 1B), which had > 2-fold differences of expression levels between angiosarcoma and hemangioma (Figure 1B). [score:9]
Among them, 5 selected tumor relevant miRNAs (miR-378-3p, miR-483-5p and miR-497-5p, miR-222-3p and miR-126-3p) were validated with semiquantitative RT-PCR in all 27 angiosarcoma and 15 hemangioma samples. [score:1]
[1 to 20 of 2 sentences]
61
[+] score: 10
Thus, overexpression of nephronectin 3′UTR acted as a miRNA “sponge”, inducing the sequestration of miR-378, which in turn released the inhibition of this miRNA on GalNT7 mRNA [4]. [score:5]
A first evidence that a miRNA can play a role in regulating the expression of enzymes involved in protein glycosylation was obtained serendipitously in a study aimed to analyze the effects of miR-378 on nephronectin, a ligand for integrin α8β1 [4]. [score:4]
In fact, a competition for miR-378 binding was observed between nephronectin and UDP-N-acetyl-alpha-D-galactosamine: polypeptide N-acetyl-galactosaminyltransferase 7 (GalNT7) 3′UTRs. [score:1]
[1 to 20 of 3 sentences]
62
[+] score: 9
The top most highly expressed miRNAs in ERBB2 overexpressing cell lines included hsa-let-7b, hsa-miR-640, hsa-miR-200c, hsa-miR-378, hsa-miR-141, hsa-miR-196a, hsa-miR-29c, and hsa-miR-18a*, whereas hsa-miR-501-5p, hsa-miR-202, hsa-miR-760, and hsa-miR-626 were more highly expressed in luminal cell lines lacking ERBB2 overexpression (fold change ≥ 1.5) (see Table S8 in Additional file 1). [score:9]
[1 to 20 of 1 sentences]
63
[+] score: 9
To confirm the microarray hybridization results, qRT-PCR was performed on 8 up-regulated miRNAs (miR-335, miR-146b-5p, miR-26b, miR-30b, miR-21, miR-378, miR-143 and miR-148a) [10] and 3 down-regulated miRNA (miR-155,miR-221, and miR-1275), chosen on the basis of their levels of expression on the microarray and their biological significance. [score:9]
[1 to 20 of 1 sentences]
64
[+] score: 9
A group of 39 miRNAs was significantly down-regulated by Nkx2-1 knock-down including miR-1195 (−4.9 fold), miR-378 (−4.6 fold), miR-449a (−2.1 fold), and miR-130a (−1.9 fold) (Figure  2A and Table  1). [score:5]
Expression patterns of the most altered miRNAs (miR-200c, miR-221, miR-1195, and miR-378) were analyzed in Nkx2-1 knock-down cells by RT-qPCR (Figure  2B) confirming the microarray data. [score:4]
[1 to 20 of 2 sentences]
65
[+] score: 9
For example, the human miRNA has-miR-378 is predicted to have a target site in the mRNA corresponding to human gene BCL7A, while mmu-miR-378, the mouse ortholog of has-miR-378, has a target site in the mRNA for Bcl7a (the orthologous gene in mouse). [score:5]
We thus consider the has-miR-378 target site in BCL7A to have an ortholog in mouse, and infer that regulation of these genes by this miRNA has been evolutionarily conserved between human and mouse. [score:4]
[1 to 20 of 2 sentences]
66
[+] score: 8
Furthermore, Th2-type inflammation induces macrophage proliferation and anti-proliferative miR-378 expression simultaneously, suggesting a complex regulation of in situ macrophage proliferation [19]. [score:4]
For instance, miR-125b-5p, miR-199b, and miR-378-3p showed elevated expression in nematode infection-elicited alternative macrophage activation [19]. [score:3]
Among these miRNAs, miR-378-3p has been shown to repress IL-4 -driven macrophage proliferation through the modulation of the PI3K/AKT signaling pathway [19]. [score:1]
[1 to 20 of 3 sentences]
67
[+] score: 8
It is known that type I IFNs increase granzyme B, perforin, IFNγ, TNFα, and NKG2A mRNA levels (Mori et al., 1998; Martinez et al., 2008), suppressing two miRNA (miR-378 and miR30e) that negatively regulate perforin and granzyme B expression in resting NK cells (Wang et al., 2012). [score:6]
Identification of resting and type I IFN-activated human NK cell miRNomes reveals microRNA-378 and microRNA-30e as negative regulators of NK cell cytotoxicity. [score:2]
[1 to 20 of 2 sentences]
68
[+] score: 8
Though Hou et al. found that the expression level of miR-378 increased at 65 and 90 dpc and peaked at postnatal day 0, these results both suggested that miRNA-378 was a new candidate miRNA for myogenesis in pigs (Hou et al., 2012; Qin et al., 2013). [score:3]
In our study, miR-378 showed the highest expression level in the E90 stage. [score:3]
For example, miR-378 promotes myogenesis in pigs through regulation of bone morphogenetic protein 2 (BMP2) and mitogen-activated protein kinase 1 (MAPK1), especially in fiber formation in both the fetal and newborn periods (Hou et al., 2012). [score:2]
[1 to 20 of 3 sentences]
69
[+] score: 8
In colorectal cancer, the presence of the KRAS mutation was associated with upregulation of miR-127-3p, miR-92a, and miR-486-3p and downregulation of miR-378, which constituted a miRNA signature capable of predicting colorectal cancers resistant to EGFR antagonists [54]. [score:8]
[1 to 20 of 1 sentences]
70
[+] score: 8
Finally, miR-378 increases brown fat mass and as a consequence, suppresses development of beige adipocytes in subcutaneous WAT [23]. [score:4]
Several miRNAs controlling mouse brown adipocyte development and function have been identified in mice, including miR-27, −34a, −133, −155, −182, −193b-365, −196, −203 and miR-378 [14, 16– 23]. [score:2]
This phenotype is supported by the absence of miR-378, a key regulator controlling classical BAT-specific expansion and obesity resistance [23]. [score:2]
[1 to 20 of 3 sentences]
71
[+] score: 8
Over -expression of miR-378 attenuates high glucose -suppressed osteogenic differentiation through the targeting CASP3 and activating the PI3 K/Akt pathway [32]. [score:7]
Interestingly, microRNAs with the highest changes were related to the osteogenesis of BMSC, including has-miR-146a, has-miR-135b, miR-378, miR-335-5p and miR-210. [score:1]
[1 to 20 of 2 sentences]
72
[+] score: 7
The expression profile of infected and uninfected cells was evaluated using a miRNA microarray, and 16 miRNAs were reported to be up-regulated (miR-4290, miR-4279, miR-625*, miR-let-7e, miR-1290, miR-33a, miR-3686, miR-378, miR-1246, miR-767-5p, miR-320c, miR-720, miR-491-3p, miR-3647, miR-451 and miR-4286) and 4 down-regulated (miR-106b, miR-20a, miR-30b and miR-3653) during dengue infection. [score:7]
[1 to 20 of 1 sentences]
73
[+] score: 7
After primary miRNA microarray analysis, in PCa tissues, five miRNAs (miR-345, miR-145, miR-221, miR-27b and miR-378) were down-regulated and twenty-two miRNAs were up-regulated (Figure 1). [score:7]
[1 to 20 of 1 sentences]
74
[+] score: 7
In a comparison between the pig breeds, 49 dpc showed the most significant differences in G1 (up-regulated), in which miR-378, miR-30a, miR-148a, and miR-127 showed drastic changes. [score:4]
Ganesan J miR-378 prevents cardiomyocyte hypertrophy through repression of four factors in the MAP kinase pathwayNaunyn-Schmiedebergs Arch. [score:1]
miR-378 prevents cardiomyocyte hypertrophy through the repression of four components of the MAP kinase pathway [19]. [score:1]
Figure  3 shows that in G1 (up), we clearly found that 49 dpc showed the most significant differences between breeds; in this group, miR-378, miR-148a and miR-127 showed drastic changes. [score:1]
[1 to 20 of 4 sentences]
75
[+] score: 7
On the other hand, we found eight down-regulated miRNAs, some of them implicated in multiple processes such as cancer (miR20b-5p, miR-1291) 52, 53, organ injury in toxicity drug mo dels (miR-382-5p) [54], metabolic processes and steroidogenesis (miR-378b) [55], and tissue inflammation (miR-3085-3p) [56]. [score:4]
Pan B Toms D Shen W Li J MicroRNA-378 regulates oocyte maturation via the suppression of aromatase in porcine cumulus cellsAm. [score:3]
[1 to 20 of 2 sentences]
76
[+] score: 7
The comparison between control- and MPA -treated cells revealed that 16 miRNAs were significantly modulated by more than two-fold (P < 0.05, Figure 1A), nine miRNAs were upregulated (miR-191*, miR-17*, miR- 470*, miR-451, miR-702, miR-434-3p, miR-493, miR-23a* and miR-485*) and seven were downregulated (miR-378*, miR-376a, miR-224, miR-190b, miR-16, miR-410 and miR-197) (Figure 1B). [score:7]
[1 to 20 of 1 sentences]
77
[+] score: 7
Compared to normal tissue with an expression profile normalized to 1, in tumor samples of the 14 CRC patients we observed a significant up-regulation for 3 miRNAs (miR-31, miR-21 and miR-708), and under expression in 7 others (miR-145, miR-139-5p, miR-486-5p, miR-378, miR-140-3p, miR-143 and miR-30c) (Table 3). [score:7]
[1 to 20 of 1 sentences]
78
[+] score: 6
In addition, miR-378 inhibited the expression of two PGC-1β partners, ERRγ and GABPA, leading to metabolic shift of cancer cells [91]. [score:5]
miR-378* mediates metabolic shift in breast cancer cells via the PGC-1β/ERRγ transcriptional pathway. [score:1]
[1 to 20 of 2 sentences]
79
[+] score: 6
MicroRNA-378-5p suppresses cell proliferation and induces apoptosis in colorectal cancer cells by targeting BRAF. [score:4]
Although BRAF has not been shown to have a direct relationship with many miRNAs, one report has characterized BRAF mRNA as a target of the miR-378 anti-oncomiR in CRC (Wang et al., 2015c). [score:2]
[1 to 20 of 2 sentences]
80
[+] score: 6
However, seven miRNAs were either upregulated or downregulated in Exos when compared to whole cells: miR-16-5p, miR-21-5p, miR-200b-3p, miR-205-5p, miR-222-3p, miR-320a, miR-378-3p. [score:6]
[1 to 20 of 1 sentences]
81
[+] score: 6
Of them, hsa-miR-378 is located in the intron of protein-coding genes PPARGC1B, an experimentally validated transcriptional targets of MYC [40], and another eight miRNAs (hsa-miR-17, hsa-miR-19a, hsa-miR-19b, hsa-miR-20b, hsa-miR-92, hsa-miR-106a, hsa-miR-25, and hsa-miR-106b) belong to three paralogous clusters located on chromosome 13 (the hsa-miR-17 cluster), chromosome X (the hsa-miR-106a cluster), and chromosome 7 (the hsa-miR-106b cluster), with the former two clusters having been proved to be regulated by MYC [41]. [score:4]
In our network, MYC was predicted to regulate 10 miRNAs: miR-378, hsa-miR-17, hsa-miR-19a, hsa-miR-19b, hsa-miR-20b, hsa-miR-92, hsa-miR-106a, hsa-miR-25, and hsa-miR-106b, and hsa-miR-125b. [score:2]
[1 to 20 of 2 sentences]
82
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7e, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-99a, hsa-mir-100, hsa-mir-101-1, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-10a, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-215, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-141, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-194-1, hsa-mir-195, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-130b, hsa-mir-302c, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-324, hsa-mir-451a, hsa-mir-483, hsa-mir-484, hsa-mir-486-1, hsa-mir-500a, hsa-mir-92b, hsa-mir-595, hsa-mir-596, hsa-mir-421, hsa-mir-378d-2, hsa-mir-744, hsa-mir-885, hsa-mir-939, hsa-mir-940, hsa-mir-1229, hsa-mir-1233-1, hsa-mir-1290, hsa-mir-1246, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-718, hsa-mir-378c, hsa-mir-4306, hsa-mir-4286, hsa-mir-500b, hsa-mir-1233-2, hsa-mir-3935, hsa-mir-642b, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-3976, hsa-mir-4644, hsa-mir-203b, hsa-mir-451b, hsa-mir-378j, hsa-mir-486-2
Genome-wide miRNA expression profiles followed by RT-qPCR assays revealed that miR-378 yielded an AUC of 0.861 with 87.5% sensitivity and 70.73% specificity. [score:2]
Zanutto S. Pizzamiglio S. Ghilotti M. Bertan C. Ravagnani F. Perrone F. Leo E. Pilotti S. Verderio P. Gariboldi M. Circulating miR-378 in plasma: A reliable, haemolysis-independent biomarker for colorectal cancer Br. [score:1]
Liu H. Zhu L. Liu B. Yang L. Meng X. Zhang W. Ma Y. Xiao H. Genome-wide microRNA profiles identify miR-378 as a serum biomarker for early detection of gastric cancer Cancer Lett. [score:1]
Another group identified miR-378 in peripheral blood samples as a screening marker or follow-up marker for CRC patients [40]. [score:1]
Collectively, these findings support our contention that circulating miR-378 has potential as a novel non-invasive biomarker in the detection of GC [24]. [score:1]
[1 to 20 of 5 sentences]
83
[+] score: 6
MiR-378 enhances cell survival, tumor growth and angiogenesis through suppressing the expression of two tumor suppressors, Sufu and Fus-1 [10]. [score:6]
[1 to 20 of 1 sentences]
84
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-22, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-98, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-101a, mmu-mir-126a, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-142a, mmu-mir-181a-2, mmu-mir-194-1, hsa-mir-208a, hsa-mir-30c-2, mmu-mir-122, mmu-mir-143, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-208a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29c, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-20a, rno-mir-101b, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-17, mmu-mir-19a, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-19b-1, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19a, rno-mir-22, rno-mir-26a, rno-mir-26b, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30c-2, rno-mir-98, rno-mir-101a, rno-mir-122, rno-mir-126a, rno-mir-130a, rno-mir-133a, rno-mir-142, rno-mir-143, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-194-1, rno-mir-194-2, rno-mir-208a, rno-mir-181a-1, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, ssc-mir-122, ssc-mir-15b, ssc-mir-181b-2, ssc-mir-19a, ssc-mir-20a, ssc-mir-26a, ssc-mir-326, ssc-mir-181c, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-18a, ssc-mir-29c, ssc-mir-30c-2, hsa-mir-484, hsa-mir-181d, hsa-mir-499a, rno-mir-1, rno-mir-133b, mmu-mir-484, mmu-mir-20b, rno-mir-20b, rno-mir-378a, rno-mir-499, hsa-mir-378d-2, mmu-mir-423, mmu-mir-499, mmu-mir-181d, mmu-mir-18b, mmu-mir-208b, hsa-mir-208b, rno-mir-17-2, rno-mir-181d, rno-mir-423, rno-mir-484, mmu-mir-1b, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, ssc-mir-17, ssc-mir-130a, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-1, ssc-mir-181a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-499, ssc-mir-143, ssc-mir-423, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-98, ssc-mir-208b, ssc-mir-142, ssc-mir-19b-1, ssc-mir-22, rno-mir-126b, rno-mir-208b, rno-mir-133c, hsa-mir-378c, ssc-mir-194b, ssc-mir-133a-2, ssc-mir-484, ssc-mir-30c-1, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, mmu-mir-101c, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-18b, hsa-mir-378j, rno-mir-378b, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-mir-451b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-194a, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, rno-let-7g, rno-mir-15a, ssc-mir-378b, rno-mir-29c-2, rno-mir-1b, ssc-mir-26b
miR-101, miR-378 and 143 expression patterns. [score:3]
The expression of miR-378 was highly variable among the tissues tested (Figure 2E). [score:3]
[1 to 20 of 2 sentences]
85
[+] score: 5
A number of miRNAs have been reported to target caspase-3. miR-378 has been reported to attenuate apoptosis of cardiomyocytes by targeting caspase-3 [33]. [score:5]
[1 to 20 of 1 sentences]
86
[+] score: 5
Hou et al. [40] showed that ssc-miR-206, ssc-miR-378, and ssc-miR-1 were expressed at extremely high levels in the longissimus dorsi muscles of Tong Cheng pigs. [score:3]
Two miRNAs, ssc-miR-26a [29, 30] and ssc-miR-378 [31], that ranked 2 [nd] and 3 [rd], respectively, have been reported to be involved in the proliferation and differentiation processes of skeletal muscle. [score:1]
In the present study, we found that ssc-miR-206, ssc-miR-378, and ssc-miR-1 were ranked 1 [st], 3 [rd], and 4 [th] in abundance among the ten libraries, which is consistent with the previous study. [score:1]
[1 to 20 of 3 sentences]
87
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-30a, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-105-1, hsa-mir-105-2, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-205, hsa-mir-212, hsa-mir-181a-1, hsa-mir-222, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-141, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-188, hsa-mir-320a, hsa-mir-181b-2, hsa-mir-30c-1, hsa-mir-302a, hsa-mir-34c, hsa-mir-30e, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-372, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-383, hsa-mir-339, hsa-mir-133b, hsa-mir-345, hsa-mir-425, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-193b, hsa-mir-181d, hsa-mir-498, hsa-mir-518f, hsa-mir-518b, hsa-mir-520c, hsa-mir-518c, hsa-mir-518e, hsa-mir-518a-1, hsa-mir-518d, hsa-mir-518a-2, hsa-mir-503, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-376a-2, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-645, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-744, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-302e, hsa-mir-302f, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-320e, hsa-mir-548x, hsa-mir-378c, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, hsa-mir-371b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
Three different miRNAs, miR-224, miR-378, and miR-383, have been found to be involved in the regulation of aromatase expression during follicle development. [score:5]
[1 to 20 of 1 sentences]
88
[+] score: 5
Instead, miR-378, miR-10b and miR-95 were expressed mainly in HLSCs and miR-369-5p, miR-594 and miR-654, were expressed mainly in MSCs rather than in their MVs, suggesting that these miRNAs were not compartmentalized within MVs and therefore not secreted. [score:5]
[1 to 20 of 1 sentences]
89
[+] score: 5
By comparing the miRNA expression between patients that achieved complete response with no recurrence within 6 months of the end of treatment and patients that progressed really rapidly after treatment, the authors identified seven miRNAs to be significantly differentially expressed, including hsa-miR-27a, 23a, miR-378. [score:5]
[1 to 20 of 1 sentences]
90
[+] score: 5
In luciferase reporter Construct II, the inserted fragment of VEGF 3′-UTR contains 1 putative targeting site for miR-378, located at nt842–864. [score:3]
However, when cells were co -transfected with miR-378 and one of these four miRNAs, the repressive effect of these miRNAs decreased significantly. [score:1]
In the case of miR-125a, which shares the same seed region with miR-378, the repressive activity of miR-125a was abolished completely, suggesting a competitive interaction between these two miRNAs. [score:1]
[1 to 20 of 3 sentences]
91
[+] score: 5
Several miRNAs (miR-29a, miR-29b, miR-149, miR-378, miR-324-5p) targeted to the human immunodeficiency virus (HIV) genome and inhibited viral infection in T cells [14]. [score:5]
[1 to 20 of 1 sentences]
92
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-198, hsa-mir-129-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-196a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-382, hsa-mir-383, hsa-mir-151a, hsa-mir-148b, hsa-mir-338, hsa-mir-133b, hsa-mir-325, hsa-mir-196b, hsa-mir-424, hsa-mir-20b, hsa-mir-429, hsa-mir-451a, hsa-mir-409, hsa-mir-412, hsa-mir-376b, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-181d, hsa-mir-499a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-301b, hsa-mir-216b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-320e, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j
Functional involvement of miR-224, miR-378, and miR-382 in regulation of aromatase expression during follicle development has been demonstrated, and miR-21 promoted follicular cell survival during the ovulation (Donadeu et al. 2012). [score:5]
[1 to 20 of 1 sentences]
93
[+] score: 5
In the down-regulated group, there are seven miRNA pairs (miR-139, miR-29c, miR-145, miR-378, miR-30a, miR-143 and miR-144) with both the 5p-arm and 3p-arm identified as significantly dys-regulated miRNAs. [score:5]
[1 to 20 of 1 sentences]
94
[+] score: 5
Global microRNA expression analysis demonstrated that the expression of seven microRNAs, including miR-378, miR-689 miR-21, miR-574-5P, miR-696 miR-370 miR-21, that were significantly altered during liver regeneration [16] were not altered during the hepatic differentiation of hUC-MSCs in our study. [score:5]
[1 to 20 of 1 sentences]
95
[+] score: 5
The elevated expression of miR-16, miR-25, miR-92a, and miR-378 and the decreased expression of miR-22, miR-27a, miR-29a, and miR-100 were attributed to viral oncoprotein E6 or E7 [24, 25]. [score:5]
[1 to 20 of 1 sentences]
96
[+] score: 5
Interestingly, all these miRNA target sites mapped to the viral RNA regions encoding viral accessory proteins: the nef gene harbored target sites for miRNAs miR-29a and miR-29b, the vpr for miR-149, the vif for miR-324-5p, and vpu for miR-378 (Figure 2 and Table 1). [score:5]
[1 to 20 of 1 sentences]
97
[+] score: 5
Similar inhibitory mechanisms (targeting MDV in this case) have been reported for miR-23, miR-378, and miR-505 (133). [score:5]
[1 to 20 of 1 sentences]
98
[+] score: 5
Primer Sequence (5'-3') ssc-miR-128-forward TCACAGTGAACCGGTCTCTTT ssc-miR-15b-forward TAGCAGCACATCATGGTTTACA ssc-miR-185-forward TGGAGAGAAAGGCAGTTCCTGA ssc-miR-221-3p-forward AGCTACATTGTCTGCTGGGTTT ssc-miR-378-forward ACTGGACTTGGAGTCAGAAGGC ssc-miR-novel-43-forward TTCAAGTAACCCAGGATAGGCT ssc-miR-novel-269-forward TACCCATTGCATATCGGAGTTG miR-reverse GTCGGTGTCGTGGAGTCG U6-forward TCGCTTTGGCAGCACCTAT U6-reverse AATATGGAACGCTTCGCAAA Poly(T) adapter GTCGGTGTCGTGGAGTCGTTTGCAATTGCACTGGATTTTTTTTTTTTTTTTTTV V = A, G, C. Figure 4 Validation of miRNA expression by RT-qPCR. [score:2]
Primer Sequence (5'-3') ssc-miR-128-forward TCACAGTGAACCGGTCTCTTT ssc-miR-15b-forward TAGCAGCACATCATGGTTTACA ssc-miR-185-forward TGGAGAGAAAGGCAGTTCCTGA ssc-miR-221-3p-forward AGCTACATTGTCTGCTGGGTTT ssc-miR-378-forward ACTGGACTTGGAGTCAGAAGGC ssc-miR-novel-43-forward TTCAAGTAACCCAGGATAGGCT ssc-miR-novel-269-forward TACCCATTGCATATCGGAGTTG miR-reverse GTCGGTGTCGTGGAGTCG U6-forward TCGCTTTGGCAGCACCTAT U6-reverse AATATGGAACGCTTCGCAAA Poly(T) adapter GTCGGTGTCGTGGAGTCGTTTGCAATTGCACTGGATTTTTTTTTTTTTTTTTTV V = A, G, C. Figure 4 Validation of miRNA expression by RT-qPCR. [score:2]
Seven candidate miRNAs were randomly selected: two novel miRNAs (ssc-miR-novel-43 and ssc-miR-novel-269) and five known miRNAs (ssc-miR-128, ssc-miR-15b, ssc-miR-185, ssc-miR-221-3p and ssc-mir-378). [score:1]
[1 to 20 of 3 sentences]
99
[+] score: 4
MicroRNA-195 and microRNA-378 mediate tumor growth suppression by epigenetical regulation in gastric cancer. [score:4]
[1 to 20 of 1 sentences]
100
[+] score: 4
Moreover, several studies have identified the regulatory role of microRNAs in Hsp70 expression, such as miR-378* and miR-711 [33], miRNA-1, miRNA-21, and miRNA-24 [34]. [score:4]
[1 to 20 of 1 sentences]