sort by

26 publications mentioning mmu-mir-467a-7

Open access articles that are associated with the species Mus musculus and mention the gene name mir-467a-7. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 30
Among the ten miRNAs validated by qRT-PCR, we found that mmu-miR-487b-5p, mmu-miR-709, mmu-miR-182-5p, mmu-miR-214-3p and mmu-miR-467a-3p were up-regulated in HCC-activated Tregs, mmu-miR-142-5p, mmu-miR-30b-5p, mmu-miR-409-3p and mmu-miR-129-5p were down-regulated (P < 0.01), while miR-344e-5p did not change significantly, as shown in Figure 1C. [score:7]
There were four up-regulated miRNAs (mmu-miR-709, mmu-miR-467a-3p, mmu-miR-182-5p and mmu-miR-25-5p) and seven down-regulated miRNAs (mmu-miR-615-3p, mmu-miR-409-3p, mmu-miR-680, mmu-miR-129-5p, mmu-miR-151-5p, mmu-miR-142-5p and mmu-miR-30b-5p), as the values presented in Table 1. Then we performed unsupervised hierarchical clustering of the eleven miRNAs. [score:7]
Control) P -valuemmu-miR-25-5p2.210.04mmu-miR-7091.980.02mmu-miR-467a-3p1.820.04mmu-miR-182-5p1.540.05mmu-miR-129-5p0.290.02mmu-miR-6800.340.02mmu-miR-615-3p0.360.00mmu-miR-409-3p0.440.02mmu-miR-30b-5p0.510.05mmu-miR-151-5p0.610.03 mmu-miR-142-5p 0.63 0.04By TargetScan, we found that mmu-miR-25-5p, mmu-miR-615-3p, mmu-miR-151-5p and mmu-miR-680 had few target genes directly relating with Tregs in MeSH database, so we excluded the four miRNAs for further exploration. [score:6]
Because miR-487b-5p, miR-709 and miR-467a-3p did not express in human tissue (miRBase 19), we validated the expression levels of the rest six miRNAs. [score:5]
Because miR-487b-5p, miR-709 and miR-467a-3p did not express in human tissue (miRBase 19), we checked the expression levels of the rest six miRNAs in Tregs from peripheral blood samples. [score:5]
[1 to 20 of 5 sentences]
2
[+] score: 29
Distinct groups of miRNAs regulated by IAV infection could be defined: (1) miRNAs (n = 39) whose expression correlated with hemagglutinin (HA) mRNA expression and represented the general response to IAV infection independent of host genetic background; (2) miRNAs (n = 20) whose expression correlated with HA mRNA expression but differed between the two strains; and (3) remarkably, miR-147-3p, miR-208b-3p, miR-3096a-5p, miR-3069b-3p, and the miR-467 family, whose abundance even in uninfected lungs differentiated nearly perfectly (area under the ROC curve > 0.99) between the two strains throughout the time course, suggesting a particularly strong association with the differential susceptibility of the two mouse strains. [score:10]
Before infection, host susceptibility was particularly associated with consistently higher expression of miR-208b-3p, miR-3096b-3p, and the miR-467 family and lower expression of miR-3096a-5p and the potentially anti-inflammatory miR-147-3p. [score:5]
Taken together, the above results suggest (1) that the selective expression of several IAV-regulated miRNAs, including miR-147-3p, miR-208b-3p, miR-3096a-5p, miR-3069b-3p, and the miR-467 family, in uninfected and incipiently infected DBA/2J lungs was specifically associated with higher susceptibility of this mouse strain to IAV infection at later time points and (2) that it accurately predicted this higher susceptibility. [score:4]
Many miRNAs whose expression differed between DBA/2J and C57BL/6J mice during infection belong to the miR-467, miR-449, and miR-34 families. [score:3]
In total, there were eight differentially expressed miRNAs with AUCs > 0.99 (miR-147-3p, miR-208b-3p, miR-467a-5p, miR-467c-5p, miR-467d-5p, miR-467e-5p, miR-3096a-5p, and miR-3096b-3p) whose abundance changed significantly during infection. [score:3]
Higher abundance of antiapoptotic (e. g., miR-467 family) and lower abundance of proapoptotic miRNAs (e. g., miR-34 family) and those regulating the PI3K-Akt pathway (e. g., miR-31-5p) were associated with the more susceptible DBA/2J strain. [score:2]
Overall, miRNAs belonging to the miR-467 family were over-represented in this group of strain-specific miRNAs: 11 miRNAs of this family were among the 473 miRNAs that passed initial data filtering (see ), and nine of them had AUCs > 0.946. [score:1]
The miR-467 family was strongly represented in this group. [score:1]
[1 to 20 of 8 sentences]
3
[+] score: 29
The expression of nuclear-enriched miR-690 and miR-467a* did not show anti-correlation with that of mature miRNAs processed from their putative pri-miRNA targets (Figure 6A). [score:5]
Expression of miR-467a*, interestingly, was enriched only in the nucleus of LSK and promyelocytes, while expression of miR-135* and miR-142-3p did not appear to be nuclear-enriched in any myeloid population (Figure 5B). [score:5]
Nuclear expression of miR-709, miR-706, miR-690 and miR-467a* in hemopoietic cell lines. [score:3]
We predicted pri-miRNA targets of the four nuclear-enriched miRNAs: miR-709, miR-706, miR-467a* and miR-690 during mouse granulopoiesis using RNAhybrid [41]. [score:3]
In order to characterize the extent of the nuclear expression of these miRNAs, we analyzed the expression of miR-709, miR-706, miR-690 and miR-467a* in four mouse hemopoietic cell lines: MPRO, EL4, MEL and A20. [score:3]
Predicted pri-miRNA targets of nuclear-enriched miR-709, miR-706, miR-467a* and miR-690. [score:3]
There were four nuclear-enriched miRNAs that are ubiquitously present in mouse hemopoietic cells, including two miRNAs, miR-467a* and miR-706 that have never been reported to be nuclear-enriched. [score:1]
It is interesting to note the enrichment of miR-706 and miR-467a* in the nucleus of primary mouse hemopoietic cells and cell lines because these miRNAs have not been reported as being nuclear-enriched in other cell types [23- 31]. [score:1]
All four nuclear-enriched miRNAs, miR-709, miR-706, miR-690 and miR-467a* in hemopoietic cells are mouse specific miRNAs. [score:1]
Nuclear enrichment of miR-467a* is specific to hemopoietic stem/progenitors and promyelocytes. [score:1]
Amongst these 6 miRNAs, miR-706 and miR-467a* (now renamed miR-467a-3p) had nuclear:cytoplasmic ratios > 1 in promyelocytes (Additional file 5). [score:1]
Both RT-qPCR and western blotting confirm the range of detection and enrichment of nuclear and cytoplasmic fractions (B) Nuclear-enriched miR-709, miR-706, miR-467a* and miR-690 in primary mouse LSK cells, promyelocytes, myelocytes and granulocytes. [score:1]
miR-467a* was significantly enriched in the nucleus of MPRO, EL4 and A20 (p < 0.05) (Figure 5C). [score:1]
[1 to 20 of 13 sentences]
4
[+] score: 25
Specifically, during severe Plasmodium infection, miR-146a and/or miR-193b regulate functions such as production of inflammatory cytokines (also involving miR-467a), recruitment of macrophages, increased nitric oxide production, disruption of neuronal function, as well as modulation of the expression of surface molecules controlling interactions between circulating cells and endothelial cells [4, 64]. [score:4]
Dot plots show the expression levels of miR-146a, miR-193b, miR-205, miR-215, miR-467a, miR-150, and miR-486 measured for MV, MV-free plasma, and brains from NI, NCM, and CM conditions, expressed as normalized values as compared to the expression of a panel of control miRNA in each case. [score:4]
The differential expression profiles of these selected miRNA (miR-146a, miR-150, miR-193b, miR-205, miR-215, miR-467a, and miR-486) were analyzed in mouse MV, MV-free plasma, and brain tissue by quantitative reverse transcription PCR (RT-qPCR). [score:3]
The direction of regulation in CM conditions was the opposite for MV and brain tissue in the case of miR-150, miR-205, miR-193b, and miR-467a. [score:3]
A further four miRNA—miR-150, miR-215, miR-467a, and miR-486 showed the same directional change in abundance as in the, without reaching significance (Fig.   4). [score:2]
NI MV OpenArray RT-qPCR hsa-miR-328 − 2.5* ± 0.93Not tested [a] hsa-miR-335* − 3.0* ± 1.13Not tested [a] mmu-miR-16* 2.8** ± 0.65Not tested [a] mmu-miR-21* 5.0** ± 0.88Not tested [a] mmu-miR-297a* 5.8* ± 1.60Not tested [a] mmu-miR-685 3.0* ± 1.00Not tested [a] mmu-miR-1949 5.0* ± 1.69Not tested [a] hsa-miR-590-5p Unique to NINot validated [b] rno-miR-450 Unique to CMNot validated [b] mmu-miR-10b 2.7* ± 0.85Not validated [b] hsa-miR-146a 3.2** ± 0.68 7.2* ± 2.74 hsa-miR-150 1.8* ± 0.64 2.7 (ns) ± 2.26 hsa-miR-205 2.3* ± 0.75 − 0.5 (ns) ± 1.89 hsa-miR-486 2.3*** ± 0.18 4.7 (ns) ± 1. 45 mmu-miR-193b − 2.7** ± 0.62 − 7.5* ± 0 62 mmu-miR-215 2.1* ± 0.554.6 (ns) ± 99.39 [c] mmu-miR-467a − 2.0* ± 0.69 − 5.6 (ns) ± 0.96 The list of significantly differentially expressed miRNA in CM vs NI MV from the was compared with the results obtained by. [score:2]
miR-146a and miR-467a also showed significant changes in the MV-free plasma. [score:1]
The results are presented as follows: significant changes in MV – miR-146a and miR-193b, significant changes in the brain—miR-205, miR-215, and miR-467a, no significant changes—miR-150 and miR-486. [score:1]
To summarize, three miRNA: miR-146a, miR-193b, and miR-467a, control 10 genes within the malaria pathway: CD40 ligand (CD40L, CD154), CXCL8 (IL-8), IFNγ, Integrin β2 (ITGβ2), Transforming Growth Factor β2 (TGFβ2), Thrombospondin genes (THBS1/TSP1, THBS2/TSP2), Toll-Like Receptors (TLR2, TLR4), and TNF. [score:1]
All the remaining miRNA (Table  1, miR-146a, miR-150, miR-193b, miR-205, miR-215, mir-467a, and miR-486) were tested on MV samples as per the and also on MV-free plasma and brain tissue from NI, NCM, and CM mice. [score:1]
The database was searched with the full names of each murine miRNA as per the ThermoFisher Scientific product information and miRBase version 21: mmu-miR-16-1-3p, mmu-miR-21a-3p, mmu-miR-146a-5p, mmu-miR-150-5p, mmu-miR-193b-3p, mmu-miR-205-5p, mmu-miR-215-5p, mmu-miR-297a-3p, mmu-miR-328-3p, mmu-miR-335-3p, mmu-miR-467a-5p, mmu-miR-486a-5p, mmu-miR-685, mmu-miR-1949, and rno-miR-10b-5p. [score:1]
No significant change in the abundance of miR-150, miR-205, miR-215, miR-467a, and miR-486 in MV following Plasmodium infection. [score:1]
The results of these are denoted as * = 0.05–0.01, ** = 0.01–0.0001, *** ≤ 0.0001 No significant change in the abundance of miR-150, miR-205, miR-215, miR-467a, and miR-486 in MV following Plasmodium infectionOf the seven miRNA of interest tested by RT-qPCR, miR-146a and miR-193b showed the same significant change in abundance as in the OpenArray (from Fig.   2b). [score:1]
[1 to 20 of 13 sentences]
5
[+] score: 23
Other miRNAs from this paper: mmu-mir-466a, mmu-mir-467a-1, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-548d-1, hsa-mir-548d-2, mmu-mir-669a-1, mmu-mir-669b, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-467b, mmu-mir-669c, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-467c, mmu-mir-467d, mmu-mir-466d, mmu-mir-467e, mmu-mir-466l, mmu-mir-669k, mmu-mir-669g, mmu-mir-669d, mmu-mir-466i, mmu-mir-669j, mmu-mir-669f, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-467f, mmu-mir-466j, mmu-mir-669e, mmu-mir-467g, mmu-mir-467h, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, mmu-mir-669l, mmu-mir-669m-1, mmu-mir-669m-2, mmu-mir-669o, mmu-mir-669n, hsa-mir-548q, mmu-mir-466m, mmu-mir-669d-2, mmu-mir-466o, mmu-mir-467a-2, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-467a-3, mmu-mir-466c-2, mmu-mir-669a-6, mmu-mir-467a-4, mmu-mir-466b-4, mmu-mir-669a-7, mmu-mir-467a-5, mmu-mir-466b-5, mmu-mir-669p-1, mmu-mir-467a-6, mmu-mir-669a-8, mmu-mir-466b-6, mmu-mir-669a-9, mmu-mir-466b-7, mmu-mir-669p-2, mmu-mir-467a-8, mmu-mir-669a-10, mmu-mir-467a-9, mmu-mir-669a-11, mmu-mir-467a-10, mmu-mir-669a-12, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, hsa-mir-548s, hsa-mir-466, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-548x, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, mmu-mir-466q, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, mmu-mir-466c-3, hsa-mir-548bc
The expressions of mmu-miR-466 and mmu-miR-467 markedly waved during the hair follicle cycling in mouse [50] and were downregulated in melanoma of mouse by curcumin diet [51]. [score:6]
hsa-miR-548, mmu-miR-466, and mmu-miR-467 have an enormous number of targets on IGs, which both have the role of inhibition of host immunity response. [score:5]
The mmu-miR-466 family and mmu-miR-467 family have predicted 1,704 target sites and 956 target sites, respectively, distributed on 375 and 310 IGs of the mouse. [score:5]
We found that the hsa-miR-548 family has the highest amount of target sites among the identified miRNAs in human and the mmu-miR-466 and mmu-miR-467 families are top two in the miRNAs list predicted in the mouse. [score:3]
Both of hsa-miRNA-548 and mmu-miR-466 and mmu-miR-467 can inhibit the host immunity response [54]. [score:3]
In this study, mmu-miR-466, mmu-miR-467, and mmu-miR-669 clusters have one core promoter region and transcriptional start site shared with the Sfmbt2 gene. [score:1]
[1 to 20 of 6 sentences]
6
[+] score: 19
Among the list, members of the miR-29 family, miR-203, miR-762, and miR-1224, showed upregulation, whereas members of the miR-107 family, miR-127 and miR-130a/b, miR-342-3p, miR-351, miR-379, miR-455, and miR-467a, were downregulated in both strains. [score:7]
Notably, our data revealed that expression of Tnfsf10 (upregulated by ∼2-fold) is likely influenced by several miRNAs including miR-107, miR-145, miR-342-3p, miR-491, miR-494, miR-182, and miR-467a. [score:6]
miRNAs that were differentially expressed only in the LW during aging include miR-29c, miR-705, miR-99a, miR-127, miR-130a, miR-145, miR-151-5p, miR-379, miR-467a, and miR-574-3p. [score:3]
These miRNAs include miR-107, miR-127, miR-130a/b, miR-145, miR-342, miR-351, miR-379, miR-455, and miR-467. [score:1]
Finally, miR-467a can promote growth and survival of mouse ES cells [52]. [score:1]
miR-467a, an abundant member of the Sfmbt2 cluster, can promote cell proliferation. [score:1]
[1 to 20 of 6 sentences]
7
[+] score: 17
Table S2Sequences and expression level of the mir-302, mir-467, and mir-17-92 clusters in ES cells. [score:3]
Because deletion of Dcr involves global miRNA loss, and three additional clusters containing the same or similar hexamer seed, mir-302, mir-467, and mir-17-92, are expressed in ESCs (Table S2), we examined the 295 KO line to determine the specific contribution of the mir-295 cluster to cell survival. [score:3]
Many of the miRNAs in this cluster share the hexamer seed ‘AAGUGC,’ which is also expressed at much lower levels by the mir-302 and mir-467 clusters, contributing less than 5% of total reads (Table S2). [score:3]
50 nM miR-295, miR-467a, and miR-20a were transfected into 295 KO ES cells, and Casp2 protein expression was assayed 24 hours after the transfection. [score:2]
In support of the reporter assay, Dcr KO cells showed a comparable increase in Casp2 at the protein level, which could be partially rescued by transfection of either miR-295, miR-467a (which shares the same hexamer seed), or a Casp2 siRNA, but not by siRNAs against other unrelated targets (Figure 3B). [score:2]
50 nM miR-295, miR-467a, Bim siRNA, Casp2 siRNA and Ei24 siRNA were transfected into Dcr KO ES cells, and Casp2 protein expression was assayed 24 hours later. [score:2]
In this context, the Casp2 reporter was derepressed approximately half as strongly as it was in Dcr KO cells, suggesting that the miR-302 and miR-467a families of miRNAs incompletely compensate for loss of the mir-295 cluster (Figure 5A). [score:1]
miR-467a shares the same hexamer seed with miR-295, and Bim siRNA and Ei24 siRNA served as negative controls. [score:1]
[1 to 20 of 8 sentences]
8
[+] score: 13
We also confirmed that miR-467a was overexpressed in P7 Ercc1 [−/−] versus WT MEFs grown in 20% O [2] usingqRT-PCR (Supplemental Figure 3A) and observed that it was also overexpressed in P7 versus P3 Ercc1 [−/−] MEFs grown in 20% O [2], despite not appearing in our microarray data (Supplemental Figure 3B). [score:5]
Comparison of P7 Ercc1 [−/−] and WT MEFs grown in 20% O [2] identified one significantly upregulated miRNA, miR-467a, which was over-expressed 2.19 fold in P7 Ercc1 [−/−] MEFs compared to WT cells. [score:5]
MiR-467a may be upregulated as a result of a defect in DNA repair capacity. [score:3]
[1 to 20 of 3 sentences]
9
[+] score: 13
The annotated miRNAs in both the rat and mouse arrays are from the mir-467 family. [score:1]
The mir-467 family was acquired by amniotes approximately 350 Mya [29], and has remained relatively small; humans possess one copy on Chromosome 3, and another on the X chromosome, while pigs and orangutans possess only the X linked gene. [score:1]
Moreover, there are several mmu-mir-467 at other locations in the mouse genome. [score:1]
There are mir-467 family members in other mammalian genomes, notably human and pig, although in far fewer numbers than in rodents. [score:1]
Sequences that displayed homology with mir-467 family members were then subjected to folding with RNAFold to assess the liklihood of correct processing by Drosha and Dicer. [score:1]
Sequence analysis of this intron revealed the presence of three potential mir-467 sequences with good folding properties (Figure 7), although none of the putative pre-miRNAs resembled mouse or rat mir-467 outside of the mature miRNA sequence. [score:1]
Both possess potential mir-467 miRNA sequences in intron 10, although these do not resemble the mir-467 pre-miRNA sequences in rats and mice, apart from the putative mature miRNA. [score:1]
Note that the region with highest homology to known mir-467 family members in the Kangaroo rat is too close to the Drosha base. [score:1]
A BLAST search of intron 10 sequences against MirBase revealed that only kangaroo rats possessed a single potential mir-467 family miRNA sequence that folds appropriately with RNAFold (Figure 7). [score:1]
The miRNAs fall within the mir-467 family. [score:1]
A small segment of the rat intron close to an annotated miRNA (yellow highlighting), when subjected to MiPred reveals the presence of two additional potential mir-467 family members (green highlighting) that fold into good potential pre-miRNAs with RNAFold (http://rna. [score:1]
For example, a small random section of the rat intron was subjected to analysis with MiPred [19] to reveal the presence of two additional predicted pre-miRNA sequences from the mir-467 family (Additional file 5, Figure S5). [score:1]
Alignment of the putative pre-miRNAs with known mir-467 family members revealed the position of processed miRNAs in relation to the stem-loop (arrows). [score:1]
[1 to 20 of 13 sentences]
10
[+] score: 11
In the context of a putative role of miRNA in pGE, it is noteworthy that several mRNAs, upregulated upon mTEC maturation, showed tissue-specific expression patterns, i. e. being restricted to brain (miR-124 and miR-129), heart (miR-499), testis (miR-202), skin (miR-203) or embryo (miR-467 and miR-302). [score:6]
miR-124, miR-129, miR-202, miR-203, miR-302b and miR-467a were stably expressed at two- to tenfold higher level in the mTEC [high] subset independent of the maturation marker used for sorting the cells (Fig. 1C). [score:3]
Interestingly, miR-124, miR-129, miR-202, miR-203, miR-302b and miR-467a were differentially regulated in immature and mature Aire [neg] versus mature Aire [pos] mTEC subsets. [score:2]
[1 to 20 of 3 sentences]
11
[+] score: 8
Only three miRNAs were consistently regulated in both mo del systems with miR-155 being upregulated both in differentiating adipocytes and in obese mice and miR-466a-3p as well as miR-467 that were downregulated in both adipocytes and obese mice. [score:8]
[1 to 20 of 1 sentences]
12
[+] score: 6
In addition, miR-302 and miR-467a are expressed in mouse ES cells and supplement silencing of the miR-290–295 targets via the 2–7 U seed [16], [27]. [score:5]
This seed is shared with miRNAs that are otherwise unrelated such as the miR-430, miR-302 and miR-467a families (http://www. [score:1]
[1 to 20 of 2 sentences]
13
[+] score: 6
The miR-467 cluster in the sfmbt2 gene intron region was only expressed in mouse ESCs (Figure 5A), embryos and newborn ovaries [33, 34], but not in human and rhesus macaque ESCs, consistent with previous reports [29]. [score:3]
However, we identified three miRNA clusters (miR-467, the miRNA cluster in the imprinted Dlk1-Dio3 region and C19MC) that show distinct differences between mouse, human and rhesus macaque ESCs, which suggests species and/or lineage specific miRNA regulatory changes during evolution. [score:2]
However, we identified three miRNA clusters (miR-467, the miRNA cluster in the imprinted Dlk1-Dio3 region and C19MC) that showed clear interspecies differences. [score:1]
[1 to 20 of 3 sentences]
14
[+] score: 6
Other miRNAs from this paper: hsa-mir-25, hsa-mir-28, hsa-mir-95, mmu-mir-151, mmu-mir-290a, mmu-mir-297a-1, mmu-mir-297a-2, mmu-mir-130b, mmu-mir-340, mmu-mir-25, mmu-mir-28a, hsa-mir-130b, hsa-mir-367, hsa-mir-372, hsa-mir-378a, mmu-mir-378a, hsa-mir-340, hsa-mir-151a, mmu-mir-466a, mmu-mir-467a-1, hsa-mir-505, hsa-mir-506, mmu-mir-367, hsa-mir-92b, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-648, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-659, hsa-mir-421, hsa-mir-151b, hsa-mir-1271, hsa-mir-378d-2, mmu-mir-467b, mmu-mir-297b, mmu-mir-505, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-297c, mmu-mir-421, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-467c, mmu-mir-467d, mmu-mir-92b, mmu-mir-466d, hsa-mir-297, mmu-mir-467e, mmu-mir-466l, mmu-mir-669g, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-467f, mmu-mir-466j, mmu-mir-467g, mmu-mir-467h, mmu-mir-1195, hsa-mir-548e, hsa-mir-548j, hsa-mir-1285-1, hsa-mir-1285-2, hsa-mir-1289-1, hsa-mir-1289-2, hsa-mir-548k, hsa-mir-1299, hsa-mir-548l, hsa-mir-1302-1, hsa-mir-1302-2, hsa-mir-1302-3, hsa-mir-1302-4, hsa-mir-1302-5, hsa-mir-1302-6, hsa-mir-1302-7, hsa-mir-1302-8, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-1255a, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-1268a, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-1255b-1, hsa-mir-1255b-2, mmu-mir-1906-1, hsa-mir-1972-1, hsa-mir-548q, mmu-mir-466m, mmu-mir-466o, mmu-mir-467a-2, mmu-mir-467a-3, mmu-mir-466c-2, mmu-mir-467a-4, mmu-mir-466b-4, mmu-mir-467a-5, mmu-mir-466b-5, mmu-mir-467a-6, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-467a-8, mmu-mir-467a-9, mmu-mir-467a-10, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, hsa-mir-3116-1, hsa-mir-3116-2, hsa-mir-3118-1, hsa-mir-3118-2, hsa-mir-3118-3, hsa-mir-548s, hsa-mir-378b, hsa-mir-466, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-3156-1, hsa-mir-3118-4, hsa-mir-3174, hsa-mir-3179-1, hsa-mir-3179-2, hsa-mir-3179-3, hsa-mir-548w, hsa-mir-3156-2, hsa-mir-3156-3, hsa-mir-548x, mmu-mir-3470a, mmu-mir-3470b, mmu-mir-3471-1, mmu-mir-3471-2, hsa-mir-378c, hsa-mir-1972-2, hsa-mir-1302-9, hsa-mir-1302-10, hsa-mir-1302-11, mmu-mir-1906-2, hsa-mir-3683, hsa-mir-3690-1, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-1268b, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, mmu-mir-28c, mmu-mir-378b, mmu-mir-28b, hsa-mir-548ao, hsa-mir-548ap, mmu-mir-466q, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, mmu-mir-378c, mmu-mir-378d, hsa-mir-548ay, hsa-mir-548az, hsa-mir-3690-2, mmu-mir-290b, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-3179-4, mmu-mir-466c-3, hsa-mir-548bc, mmu-mir-1271
We have listed some RdmiR genes from the mir-467 family and some PRdmiR genes from the mir-467 family that also expanded by SD events (Table S5). [score:1]
Examples of this are the mir-297, mir-466, mir-467, mir-548 [16], mir-1302 [20], mir-1972, mir-3118 and mir-3179 families (which are all RrmiR families listed here) (Table S5). [score:1]
The most striking instance is the large mir-467 family in the mouse genome, which was derived from simple repeats. [score:1]
An example of this is the mir-467 family that is hugely expanded in mouse. [score:1]
These simple repeats have produced the largest miRNA family (mir-467 family) in mouse during the evolutionary process. [score:1]
Three miRNA families that are the results of lineage-specific expansion were found in the mouse genome: the mir-466 and mir-467 families derived from simple repeats and the mir-297 family derived from SINE and LTR repetitive elements (Table S1 and Table S2). [score:1]
[1 to 20 of 6 sentences]
15
[+] score: 5
Other miRNAs from this paper: mmu-mir-30a, mmu-mir-30b, mmu-mir-141, mmu-mir-151, mmu-mir-10b, mmu-mir-191, mmu-mir-143, mmu-mir-30e, mmu-mir-34c, mmu-mir-34b, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-21a, mmu-mir-10a, mmu-mir-139, mmu-mir-375, mmu-mir-196b, mmu-mir-465a, mmu-mir-466a, mmu-mir-467a-1, mmu-mir-669a-1, mmu-mir-669b, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-467b, mmu-mir-669c, mmu-mir-465b-1, mmu-mir-465b-2, mmu-mir-465c-1, mmu-mir-465c-2, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-467c, mmu-mir-467d, mmu-mir-466d, mmu-mir-208b, mmu-mir-467e, mmu-mir-466l, mmu-mir-669k, mmu-mir-669g, mmu-mir-669d, mmu-mir-466i, mmu-mir-669j, mmu-mir-669f, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-467f, mmu-mir-466j, mmu-mir-669e, mmu-mir-467g, mmu-mir-467h, mmu-mir-669l, mmu-mir-669m-1, mmu-mir-669m-2, mmu-mir-669o, mmu-mir-669n, mmu-mir-466m, mmu-mir-669d-2, mmu-mir-466o, mmu-mir-467a-2, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-467a-3, mmu-mir-466c-2, mmu-mir-669a-6, mmu-mir-467a-4, mmu-mir-466b-4, mmu-mir-669a-7, mmu-mir-467a-5, mmu-mir-466b-5, mmu-mir-669p-1, mmu-mir-467a-6, mmu-mir-669a-8, mmu-mir-466b-6, mmu-mir-669a-9, mmu-mir-466b-7, mmu-mir-669p-2, mmu-mir-467a-8, mmu-mir-669a-10, mmu-mir-467a-9, mmu-mir-669a-11, mmu-mir-467a-10, mmu-mir-669a-12, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, mmu-mir-466q, mmu-mir-6240, mmu-mir-30f, mmu-mir-465d, mmu-mir-466c-3
The ability of sperm-epididymosome interaction to facilitate transfer of miRNA cargo to sperm was directly assessed by RT-qPCR amplification of candidate miRNAs (miR-191, miR-375, miR-467a, miR-467d, and miR-467e) from sperm that were incubated in either media alone (sperm only) or epididymosomes (sperm + ES). [score:2]
Candidate miRNAs included representatives with the highest abundance (according to sequencing data) in epididymosomes from the proximal (caput: miR-375, miR-467a, miR-467d and miR-467e) or distal epididymis (cauda: miR-34b, miR-34c, miR-139 and miR-196b). [score:1]
Five miRNAs (miR-191, miR-375, miR-467a, miR-467d, miR-467e) were selected for inclusion in this analysis based on their high abundance in caput epididymosomes. [score:1]
Prominent among these were members of the let7, miR-30, miR-465, miR-466, miR-467, and miR-669 clusters. [score:1]
[1 to 20 of 4 sentences]
16
[+] score: 4
During the course of CIA, six miRNAs (miR-181a, miR-144, miR-17*, miR-202-3p, miR-467a* and miR-500) were up-regulated in peripheral CD3 [+] T lymphocytes of DBA-1/J strain. [score:4]
[1 to 20 of 1 sentences]
17
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-93, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-23b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-101a, mmu-mir-124-3, mmu-mir-125a, mmu-mir-130a, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-136, mmu-mir-138-2, mmu-mir-140, mmu-mir-144, mmu-mir-145a, mmu-mir-146a, mmu-mir-149, mmu-mir-152, mmu-mir-10b, mmu-mir-181a-2, mmu-mir-182, mmu-mir-183, mmu-mir-185, mmu-mir-24-1, mmu-mir-191, mmu-mir-193a, mmu-mir-195a, mmu-mir-200b, mmu-mir-204, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-204, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-200b, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-136, hsa-mir-138-1, hsa-mir-146a, hsa-mir-149, hsa-mir-185, hsa-mir-193a, hsa-mir-195, hsa-mir-320a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-93, mmu-mir-34a, mmu-mir-330, mmu-mir-339, mmu-mir-340, mmu-mir-135b, mmu-mir-101b, hsa-mir-200c, hsa-mir-181b-2, mmu-mir-107, mmu-mir-10a, mmu-mir-17, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-320, mmu-mir-26a-2, mmu-mir-221, mmu-mir-222, mmu-mir-29b-2, mmu-mir-135a-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-376a-1, mmu-mir-376a, hsa-mir-340, hsa-mir-330, hsa-mir-135b, hsa-mir-339, hsa-mir-335, mmu-mir-335, mmu-mir-181b-2, mmu-mir-376b, mmu-mir-434, mmu-mir-467a-1, hsa-mir-376b, hsa-mir-485, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, mmu-mir-485, mmu-mir-541, hsa-mir-376a-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, mmu-mir-301b, mmu-mir-674, mmu-mir-146b, mmu-mir-467b, mmu-mir-669c, mmu-mir-708, mmu-mir-676, mmu-mir-181d, mmu-mir-193b, mmu-mir-467c, mmu-mir-467d, hsa-mir-541, hsa-mir-708, hsa-mir-301b, mmu-mir-467e, mmu-mir-467f, mmu-mir-467g, mmu-mir-467h, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, mmu-mir-467a-2, mmu-mir-467a-3, mmu-mir-467a-4, mmu-mir-467a-5, mmu-mir-467a-6, mmu-mir-467a-8, mmu-mir-467a-9, mmu-mir-467a-10, hsa-mir-320e, hsa-mir-676, mmu-mir-101c, mmu-mir-195b, mmu-mir-145b, mmu-let-7j, mmu-mir-130c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
The miRNA families that change expression in both mice and rats were: mir-7, mir-9, mir-10, mir-15, mir-17, mir-26, mir-29, mir-30, mir-101, mir-130, mir-181, mir-204, mir-339, mir-340, mir-368, mir-434, mir-467. [score:3]
[1 to 20 of 1 sentences]
18
[+] score: 3
The qRT–PCR analysis of differentially expressed microRNA candidates mmu-miR-7a, mmu-miR-19b, mmu-miR-30c, mmu-miR-103, mmu-miR-107 and mmu-miR-467 that are presented in Tables 2 and 3. The expression of each miRNA was measured and normalized to that of miR295 as a control. [score:3]
[1 to 20 of 1 sentences]
19
[+] score: 3
Of these, miR-467 is edited to 48% in wild type, and hence almost half of the produced miRNAs have the potential to target different mRNAs in wild-type mice. [score:3]
[1 to 20 of 1 sentences]
20
[+] score: 3
001 Down 42 TGCATGACGGCCTGC Chrl2 MIMAT0001418 110828676 − 110828689  mmu-miR-466b-3p <0.001 Down 71 TCTTATGTGTGCGTGTA Chr2 MIMAT0004876 10395901 − 10395917 mmu-miR-467 a * <0.001 Down 169 TGTAGGTGTGTGTATGTATA Chr2 MIMAT0002108 10398019 − 10398038  mmu-miR-467b <0.001 Down 227 CATATACATGCAGGCACT Chr2 MIMAT0005448 10402887 − 10402903  mmu-miR-467e <0.001 Down 73 ACATATACATGCTCACACT Chr2 MIMAT0005293 10427362 − 10427379  mmu-miR- 5103 <0.001 Down 59 CCTCAGGGGATCCC Chr1 MIMAT0020610 34490035 + 34490023  mmu-miR- 5117 <0.001 Up 204 TAACTTTATTGATCATCACTAAC Chr1 MIMAT0020625 162967492 − 162967513  mmu-miR-582-5p <0.001 Down 69 AGTAACTGGTTGAACAACTGTA Chrl3 MIMAT0005291 110114949 − 110114969  mmu-miR-711 <0.001 Down 44 CTTACATCTCTCCCCG Chr9 MIMAT0003501 108872022 − 108872036 mmu-miR-99a * <0.001 Down 40 AGACCCATAGAAACGAGC Chrl6 MIMAT0016981 77599226 − 77599242Differentially expressed miRNAs (P < 0.05) between high- (C57L/J) and low-active (C3H/HeJ) mice strains in nucleus accumbens, EDL, and soleus. [score:3]
[1 to 20 of 1 sentences]
21
[+] score: 3
The differentially expressed miRNAs include four pairs of mature miRNAs derived from the same pre-miRNA hairpin (miR-467a and miR-467a*, miR-434-5p and miR-434-3p, miR-199a and miR-199a*, miR-126-3p and miR-126-5p). [score:3]
[1 to 20 of 1 sentences]
22
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, mmu-mir-23b, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-127, mmu-mir-128-1, mmu-mir-132, mmu-mir-133a-1, mmu-mir-188, mmu-mir-194-1, mmu-mir-195a, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-205, mmu-mir-206, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-122, mmu-mir-30e, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-205, hsa-mir-211, hsa-mir-212, hsa-mir-214, hsa-mir-217, hsa-mir-200b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-127, hsa-mir-138-1, hsa-mir-188, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-31, mmu-mir-351, hsa-mir-200c, mmu-mir-17, mmu-mir-19a, mmu-mir-100, mmu-mir-200c, mmu-mir-212, mmu-mir-214, mmu-mir-26a-2, mmu-mir-211, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-19b-1, mmu-mir-138-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-379, mmu-mir-379, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-412, mmu-mir-431, hsa-mir-431, hsa-mir-451a, mmu-mir-451a, mmu-mir-467a-1, hsa-mir-412, hsa-mir-485, hsa-mir-487a, hsa-mir-491, hsa-mir-503, hsa-mir-504, mmu-mir-485, hsa-mir-487b, mmu-mir-487b, mmu-mir-503, hsa-mir-556, hsa-mir-584, mmu-mir-665, mmu-mir-669a-1, mmu-mir-674, mmu-mir-690, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-669c, mmu-mir-696, mmu-mir-491, mmu-mir-504, hsa-mir-665, mmu-mir-467e, mmu-mir-669k, mmu-mir-669f, hsa-mir-664a, mmu-mir-1896, mmu-mir-1894, mmu-mir-1943, mmu-mir-1983, mmu-mir-1839, mmu-mir-3064, mmu-mir-3072, mmu-mir-467a-2, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-467a-3, mmu-mir-669a-6, mmu-mir-467a-4, mmu-mir-669a-7, mmu-mir-467a-5, mmu-mir-467a-6, mmu-mir-669a-8, mmu-mir-669a-9, mmu-mir-467a-8, mmu-mir-669a-10, mmu-mir-467a-9, mmu-mir-669a-11, mmu-mir-467a-10, mmu-mir-669a-12, mmu-mir-3473a, hsa-mir-23c, hsa-mir-4436a, hsa-mir-4454, mmu-mir-3473b, hsa-mir-4681, hsa-mir-3064, hsa-mir-4436b-1, hsa-mir-4790, hsa-mir-4804, hsa-mir-548ap, mmu-mir-3473c, mmu-mir-5110, mmu-mir-3473d, mmu-mir-5128, hsa-mir-4436b-2, mmu-mir-195b, mmu-mir-133c, mmu-mir-30f, mmu-mir-3473e, hsa-mir-6825, hsa-mir-6888, mmu-mir-6967-1, mmu-mir-3473f, mmu-mir-3473g, mmu-mir-6967-2, mmu-mir-3473h
WT) Musmusculus mmu-miR-205_st 0.0031763 –11.649 Musmusculus mmu-miR-200c_st 0.0246158 –3.802 Musmusculus mmu-miR-184_st 0.0170031 –3.06739 Musmusculus mmu-miR-431_st 0.00570439 –2.43854 Musmusculus mmu-miR-669e_st 0.00155807 –2.42538 Musmusculus mmu-miR-3470a_st 0.00672318 –1.97946 Musmusculus mmu-miR-491_st 0.00328488 –1.94599 Musmusculus mmu-miR-3064-5p_st 0.0276855 –1.77619 Musmusculus mmu-miR-466f_st 0.00409442 –1.75841 Musmusculus mmu-miR-2182_st 0.00532508 –1.70938 Musmusculus mmu-miR-341_st 0.0497367 –1.70718 Musmusculus mmu-miR-665-star_st 0.00544338 –1.69474 Musmusculus mmu-miR-1943-star_st 0.0157678 –1.64527 Musmusculus mmu-miR-486_st 0.0396356 –1.63793 Musmusculus mmu-miR-467a-star_st 0.00240509 –1.60868 Musmusculus mmu-miR-669f-5p_st 0.0107809 –1. [score:1]
[1 to 20 of 1 sentences]
23
[+] score: 1
Other miRNAs from this paper: mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-130a, mmu-mir-186, mmu-mir-200b, mmu-mir-202, mmu-mir-30e, mmu-let-7d, mmu-mir-130b, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-192, mmu-mir-200a, mmu-mir-15a, mmu-mir-21a, mmu-mir-29a, mmu-mir-29c, mmu-mir-93, mmu-mir-19a, mmu-mir-200c, mmu-mir-29b-2, mmu-mir-19b-1, mmu-mir-466a, mmu-mir-467a-1, mmu-mir-669a-1, mmu-mir-669b, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-467b, mmu-mir-669c, mmu-mir-709, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-467c, mmu-mir-467d, mmu-mir-574, mmu-mir-466d, mmu-mir-467e, mmu-mir-466l, mmu-mir-669k, mmu-mir-669g, mmu-mir-669d, mmu-mir-466i, mmu-mir-669j, mmu-mir-669f, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-467f, mmu-mir-466j, mmu-mir-669e, mmu-mir-467g, mmu-mir-467h, mmu-mir-669l, mmu-mir-669m-1, mmu-mir-669m-2, mmu-mir-669o, mmu-mir-669n, mmu-mir-466m, mmu-mir-669d-2, mmu-mir-466o, mmu-mir-467a-2, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-467a-3, mmu-mir-466c-2, mmu-mir-669a-6, mmu-mir-467a-4, mmu-mir-466b-4, mmu-mir-669a-7, mmu-mir-467a-5, mmu-mir-466b-5, mmu-mir-669p-1, mmu-mir-467a-6, mmu-mir-669a-8, mmu-mir-466b-6, mmu-mir-669a-9, mmu-mir-466b-7, mmu-mir-669p-2, mmu-mir-467a-8, mmu-mir-669a-10, mmu-mir-467a-9, mmu-mir-669a-11, mmu-mir-467a-10, mmu-mir-669a-12, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, mmu-mir-466q, mmu-mir-21b, mmu-mir-130c, mmu-mir-21c, mmu-mir-30f, mmu-mir-466c-3
For example, miR-466, miR-669, and miR-467 were derived from a single microRNA cluster Chromosome 2 microRNA cluster (C2MC) which might play important roles in immune response [32]. [score:1]
[1 to 20 of 1 sentences]
24
[+] score: 1
From the following groups of miRNAs with identical sequence, only the first member is annotated in the heat-map: mmu-let-7a*/mmu-let-7c-2*; mmu-miR-466a-3p/mmu-miR-466b-3p/mmu-miR-466c-3p/mmu-miR-466e-3p; mmu-miR-467a*/mmu-miR-467d*; mmu-miR-297a*/mmu-miR-297c*/mmu-miR-297b-3p and mmu-miR-199a-3p/mmu-miR-199b. [score:1]
[1 to 20 of 1 sentences]
25
[+] score: 1
The four rodent-specific miRNAs—mmu-miR-351, mmu-miR-434, mmu-miR-467a, and mmu-miR-682—were excluded from further studies. [score:1]
[1 to 20 of 1 sentences]
26
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-15a, hsa-mir-18a, hsa-mir-33a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-mir-27b, mmu-mir-126a, mmu-mir-128-1, mmu-mir-140, mmu-mir-146a, mmu-mir-152, mmu-mir-155, mmu-mir-191, hsa-mir-10a, hsa-mir-211, hsa-mir-218-1, hsa-mir-218-2, mmu-mir-297a-1, mmu-mir-297a-2, hsa-mir-27b, hsa-mir-128-1, hsa-mir-140, hsa-mir-152, hsa-mir-191, hsa-mir-126, hsa-mir-146a, mmu-let-7a-1, mmu-let-7a-2, mmu-mir-15a, mmu-mir-18a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-342, hsa-mir-155, mmu-mir-107, mmu-mir-10a, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-33, mmu-mir-211, hsa-mir-374a, hsa-mir-342, gga-mir-33-1, gga-let-7a-3, gga-mir-155, gga-mir-18a, gga-mir-15a, gga-mir-218-1, gga-mir-103-2, gga-mir-107, gga-mir-128-1, gga-mir-140, gga-let-7a-1, gga-mir-146a, gga-mir-103-1, gga-mir-218-2, gga-mir-126, gga-let-7a-2, gga-mir-27b, mmu-mir-466a, mmu-mir-467a-1, hsa-mir-499a, hsa-mir-545, hsa-mir-593, hsa-mir-600, hsa-mir-33b, gga-mir-499, gga-mir-211, gga-mir-466, mmu-mir-675, mmu-mir-677, mmu-mir-467b, mmu-mir-297b, mmu-mir-499, mmu-mir-717, hsa-mir-675, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-297c, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-467c, mmu-mir-467d, mmu-mir-466d, hsa-mir-297, mmu-mir-467e, mmu-mir-466l, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-467f, mmu-mir-466j, mmu-mir-467g, mmu-mir-467h, hsa-mir-664a, hsa-mir-1306, hsa-mir-1307, gga-mir-1306, hsa-mir-103b-1, hsa-mir-103b-2, gga-mir-10a, mmu-mir-1306, mmu-mir-3064, mmu-mir-466m, mmu-mir-466o, mmu-mir-467a-2, mmu-mir-467a-3, mmu-mir-466c-2, mmu-mir-467a-4, mmu-mir-466b-4, mmu-mir-467a-5, mmu-mir-466b-5, mmu-mir-467a-6, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-467a-8, mmu-mir-467a-9, mmu-mir-467a-10, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, hsa-mir-466, hsa-mir-3173, hsa-mir-3618, hsa-mir-3064, hsa-mir-499b, mmu-mir-466q, hsa-mir-664b, gga-mir-3064, mmu-mir-126b, gga-mir-33-2, mmu-mir-3618, mmu-mir-466c-3, gga-mir-191
The mouse host gene Sfmbt2 (Scm-like with four mbt domains 2), located on MMU2, was found to comprise the largest number of resident miRNA genes (n = 70) belonging to the mir-297, mir-466, and mir-467 gene families. [score:1]
[1 to 20 of 1 sentences]