sort by

27 publications mentioning mmu-mir-466b-6

Open access articles that are associated with the species Mus musculus and mention the gene name mir-466b-6. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 100
Other miRNAs from this paper: mmu-mir-30a, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-132, mmu-mir-134, mmu-mir-135a-1, mmu-mir-138-2, mmu-mir-142a, mmu-mir-150, mmu-mir-154, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-194-1, mmu-mir-200b, mmu-mir-122, mmu-mir-296, mmu-mir-21a, mmu-mir-27a, mmu-mir-92a-2, mmu-mir-96, rno-mir-322-1, mmu-mir-322, rno-mir-330, mmu-mir-330, rno-mir-339, mmu-mir-339, rno-mir-342, mmu-mir-342, rno-mir-135b, mmu-mir-135b, mmu-mir-19a, mmu-mir-100, mmu-mir-139, mmu-mir-212, mmu-mir-181a-1, mmu-mir-214, mmu-mir-224, mmu-mir-135a-2, mmu-mir-92a-1, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-125b-1, mmu-mir-194-2, mmu-mir-377, mmu-mir-383, mmu-mir-181b-2, rno-mir-19a, rno-mir-21, rno-mir-24-1, rno-mir-27a, rno-mir-30a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-96, rno-mir-100, rno-mir-101a, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-132, rno-mir-134, rno-mir-135a, rno-mir-138-2, rno-mir-138-1, rno-mir-139, rno-mir-142, rno-mir-150, rno-mir-154, rno-mir-181b-1, rno-mir-181b-2, rno-mir-183, rno-mir-194-1, rno-mir-194-2, rno-mir-200b, rno-mir-212, rno-mir-181a-1, rno-mir-214, rno-mir-296, mmu-mir-376b, mmu-mir-370, mmu-mir-433, rno-mir-433, mmu-mir-466a, rno-mir-383, rno-mir-224, mmu-mir-483, rno-mir-483, rno-mir-370, rno-mir-377, mmu-mir-542, rno-mir-542-1, mmu-mir-494, mmu-mir-20b, mmu-mir-503, rno-mir-494, rno-mir-376b, rno-mir-20b, rno-mir-503-1, mmu-mir-1224, mmu-mir-551b, mmu-mir-672, mmu-mir-455, mmu-mir-490, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-504, mmu-mir-466d, mmu-mir-872, mmu-mir-877, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-872, rno-mir-877, rno-mir-182, rno-mir-455, rno-mir-672, mmu-mir-466l, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, rno-mir-551b, rno-mir-490, rno-mir-1224, rno-mir-504, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, rno-mir-466d, mmu-mir-466q, mmu-mir-21b, mmu-mir-21c, mmu-mir-142b, mmu-mir-466c-3, rno-mir-322-2, rno-mir-503-2, rno-mir-466b-3, rno-mir-466b-4, rno-mir-542-2, rno-mir-542-3
DEX treatment up-regulated the expression of miRNA-483, miRNA-181a-1, miRNA-490 and miRNA-181b-1, while it down-regulated the levels of miR-122, miR-466b, miR-200b, miR-877, miR-296, miRNA-27a and precursor of miR-504. [score:9]
ACTH up-regulated the expression of miRNA-212, miRNA-182, miRNA-183, miRNA-132, and miRNA-96 and down-regulated the levels of miRNA-466b, miRNA-214, miRNA-503, and miRNA-27a. [score:9]
The levels of miR-212, miRNA-183, miRNA-182, miRNA-132, miRNA-370, miRNA-377, and miRNA-96 were up-regulated, whereas miR-125b, miRNA-200b, miR-122, miRNA-466b, miR-138, miRNA-214, miRNA-503 and miRNA27a were down-regulated in response to 17α-E2 treatment. [score:7]
Real-time PCR (qRT-PCR) measurements demonstrated that ACTH treatment upregulated the expression of miRNA-212, miRNA-183, miRNA-182, miRNA-132 and miRNA-96, while down -regulating the expression of miRNA-466b, miRNA-214, miRNA-503 and miRNA-27a. [score:7]
Real-time quantitative PCR measurements confirmed that the expression of miR-212, miRNA-183, miRNA-182, miRNA-132, miRNA-370, miRNA-377 and miRNA-96 was up-regulated and that of miRNA-122, miRNA-200b, miRNA-466b, miRNA-138, miRNA-214, miRNA-503 and miRNA-27a down-regulated in adrenals from 17α-E2 treated rats. [score:7]
qRT-PCR measurements confirmed that the expression of miR-212, miRNA-183, miRNA-182, miRNA-132, miRNA-370, miRNA-377 and miRNA-96 was up-regulated and that of miRNA-122, miRNA-200b, miRNA-466b, miRNA-138, miRNA-214, miRNA-503 and miRNA-27a down-regulated in adrenals from 17α-E2 treated rats (Fig. 3 ). [score:7]
Using qRT-PCR, we confirmed the down-regulation of miRNA-200b, miR-122, miR-19a, miRNA-466b, and miRNA-27a expression (Fig. 3 ). [score:6]
In contrast, dexamethasone down-regulated the expression of several of the miRNAs by more than 1.5 fold, i. e., miR-122 (8.2-fold), miR-466b (2.31-fold), miR-200b (1.9-fold) miR-877 (1.61-fold), miR-296 (1.61-fold)and precursor of miR-504 (1.53-fold) (Fig. 2D ). [score:6]
Bt [2]cAMP stimulation of granulosa cells caused down-regulation of a majority of miRNAs, including miRNA-200b, miRNA-466b, miRNA-27a, miRNA-214, miRNA-138 and miRNA-19a, but expression levels of miRNA-212, miRNA-183, miRNA-182, and miRNA-132 were significantly increased. [score:6]
NR5A1 was predicted to be the target gene of miR-342, while LDL-R was predicted to be the target gene of miR-182 and miR-466b. [score:5]
qRT-PCR measurements indicated that exposure of primary rat granulosa cells to Bt [2]cAMP for 24 h inhibited the expression of miRNA-200b, miRNA-466b, miRNA-27a, miRNA-214, and miRNA-138 and miRNA-19a while enhancing the expression of miRNA-212, miRNA-183, miRNA-182, and miRNA-132 (Fig. 4 ). [score:5]
Significant ACTH -induced down-regulation of miRNA-466b, miRNA-214, miRNA-503 and miRNA-27a was also observed (Fig. 3 ). [score:4]
ACTH and DEX down-regulated miR-466b more than 1.5-fold, but the effect of 17α-E2, although it showed a similar trend, was not statistically significant (p = 0.084). [score:4]
We next evaluated the effects of Bt [2]cAMP stimulation of rat ovarian granulosa cells and of mouse MLTC-1 Leydig tumor cells on the expression of twelve miRNAs (miRNA-212, miRNA-122, miRNA-183, miRNA-200b, miRNA-466b, miRNA-182, miRNA-96, miRNA-27a, miRNA-132, miRNA-214, miRNA-138 and miRNA-19a) whose adrenal expression was differentially altered in response to treatment of rats with ACTH, 17α-E2 or DEX. [score:3]
More specifically, we assessed the impact of Bt [2]cAMP treatment on the expression of miRNA-212, miRNA-122, miRNA-27a, miRNA-466b, miRNA-200b, miRNA-138, miRNA-214, miRNA-183, miRNA-182, miRNA-132, miRNA-96 and miRNA-19a. [score:3]
The levels of expression of miRNA-212, miRNA-122, miRNA-138, miRNA-214, miRNA-183, miRNA-182, miRNA-132, miRNA-96, miRNA-466b, miRNA-200b, and miRNA-19a are shown. [score:3]
A comparison of effects of ACTH and DEX shows that both hormones increased the expression miRNA-181b, miRNA-672, and miRNA-100, and significantly decreased the levels of miRNA-92a, and miRNA-466b. [score:3]
Furthermore, such DEX alteration of adrenal miRNA levels demonstrates that DEX suppression of endogenous ACTH secretion modulates a set of adrenal miRNAs, with the exception of miRNA-96, miRNA-466, and miRNA-27a, that are distinct from those modulated by treatment with exogenous ACTH. [score:3]
0078040.g003 Figure 3Quantitative RT-PCR (qRT-PCR) validation of miRNA-212, miRNA-200b, miRNA-183, miRNA-122, miRNA-19a, miRNA-466b, miRNA-182, miRNA-132, miRNA-138, miRNA-370, miRNA-96, miRNA-503, miRNA-27a and miRNA-214 levels in control, ACTH-, 17α-E2 or DEX -treated adrenals in vivo. [score:1]
Quantitative RT-PCR (qRT-PCR) validation of miRNA-212, miRNA-200b, miRNA-183, miRNA-122, miRNA-19a, miRNA-466b, miRNA-182, miRNA-132, miRNA-138, miRNA-370, miRNA-96, miRNA-503, miRNA-27a and miRNA-214 levels in control, ACTH-, 17α-E2 or DEX -treated adrenals in vivo. [score:1]
Dexamethasone treatment decreased miRNA-200b, miR-122, miR-19a, miRNA-466b and miRNA27a levels, but increased miRNA-183 levels. [score:1]
[1 to 20 of 21 sentences]
2
[+] score: 53
In the nucleus accumbens, miR-342-5p was found to be upregulated (∼115 fold) and miR-466 was downregulated (∼4 fold) in the high-active mice. [score:7]
For example, phosphofructokinase, liver, type B (Pfkl – P = 0.04) was a target gene of miR-466b-3p, and 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1 (Pfkfb1) protein was shown to be expressed higher in the low-active mice (Ferguson et al. 2014). [score:5]
MiR-466b-3p was amongst these four miRNAs (Table 3), and was determined to be differentially expressed between high- and low-active animals by qRT-PCR analysis (P < 0.0001; Fig. 1C), with no difference in expression between sexes (P = 0.908). [score:5]
MiR-466d-3p (differentially expressed in the nucleus accumbens) and miR-466b-3p (differentially expressed in the soleus) are a part of the same family of miRNAs (Table 1). [score:5]
Specifically, miR-446d-3p in the nucleus accumbens and miR-466b-3p in the soleus, were downregulated in the high-active mice (Table 3; Fig. 1B and C). [score:4]
Target gene analysis of miR-466 showed some similarity in gene families to Ferguson, et al. ’s previous protein work (Ferguson et al. 2014). [score:3]
In this study, we observed miR-466 in the nucleus accumbens and soleus to be differentially expressed between the strains. [score:3]
001 Down 42 TGCATGACGGCCTGC Chrl2 MIMAT0001418 110828676 − 110828689  mmu-miR-466b-3p <0.001 Down 71 TCTTATGTGTGCGTGTA Chr2 MIMAT0004876 10395901 − 10395917 mmu-miR-467 a * <0.001 Down 169 TGTAGGTGTGTGTATGTATA Chr2 MIMAT0002108 10398019 − 10398038  mmu-miR-467b <0.001 Down 227 CATATACATGCAGGCACT Chr2 MIMAT0005448 10402887 − 10402903  mmu-miR-467e <0.001 Down 73 ACATATACATGCTCACACT Chr2 MIMAT0005293 10427362 − 10427379  mmu-miR- 5103 <0.001 Down 59 CCTCAGGGGATCCC Chr1 MIMAT0020610 34490035 + 34490023  mmu-miR- 5117 <0.001 Up 204 TAACTTTATTGATCATCACTAAC Chr1 MIMAT0020625 162967492 − 162967513  mmu-miR-582-5p <0.001 Down 69 AGTAACTGGTTGAACAACTGTA Chrl3 MIMAT0005291 110114949 − 110114969  mmu-miR-711 <0.001 Down 44 CTTACATCTCTCCCCG Chr9 MIMAT0003501 108872022 − 108872036 mmu-miR-99a * <0.001 Down 40 AGACCCATAGAAACGAGC Chrl6 MIMAT0016981 77599226 − 77599242Differentially expressed miRNAs (P < 0.05) between high- (C57L/J) and low-active (C3H/HeJ) mice strains in nucleus accumbens, EDL, and soleus. [score:3]
Figure 1Relative expression determined by qRT-PCR of (A) miR-342-5p (P < 0.0001) and (B) miR-466 (P < 0.0004) in nucleus accumbens and (C) miR-466 (P < 0.0001) and (D) miR-1960 (P = 0.06) in the soleus between high- (C57L/J) and low- (C3H/HeJ) active mice. [score:3]
Furthermore, miR-342-5p and miR-466 in the nucleus accumbens, and miR-466 in soleus were validated by qRT-PCR to be differentially expressed between the high- and low-active mice. [score:3]
Expression of miR-466 in the soleus was ∼5 fold lower in high-active mice. [score:3]
Specifically, these authors showed that glucose deprivation caused oxidative stress, leading to histone acetylation of the miRNA promoter region, and activating expression of miR-466 h-5p and Sfmbt2. [score:3]
In the nucleus accumbens, miR-342-5p and miR-466 were validated as differentially expressed between strains by qRT-PCR, as was miR-466 in the soleus. [score:3]
BLAST search of miR-466b-3p and miR-466p-3p showed that the sequences have 100% identity matching. [score:1]
Strongly associated miRNA sequences are designated with suffixed letters, for example, miR-466b and miR-466d, which while quite similar, are derived from separate precursor sequences (Ambros et al. 2003). [score:1]
Finally, as miR-466d-3p and miR-466b-3p are 100% matching, they are noted under the same miRNA family and referred to as simply miR-466 regardless of tissue of reference. [score:1]
[1 to 20 of 16 sentences]
3
[+] score: 29
miR-466 in turn impacts lymph-angiogenesis by targeting Prox1 3′UTR sequence and suppressing the expression of the gene and therefore reducing lymphangiogenesis [95]. [score:7]
miR-466 and miR-1187, in particular, emerge as significant and regulators, sharing common target genes with Nr2e3, Rora, Ezh2 that are also differentially expressed in AMD. [score:6]
Seo M Choi J-S Rho CR Joo C-K Lee SK MicroRNA miR-466 inhibits Lymphangiogenesis by targeting prospero-related homeobox 1 in the alkali burn corneal injury mo delJ. [score:5]
In addition, the miRNAs mir466 and mir1186 have 5 potential target genes that are differentially expressed in AMD patients compared to unaffected individuals: lymphocyte cytosolic protein1 (Lcp1), NADPH oxidase 4 (Nox 4) regulator of G-protein signaling (Rgs5), Dystonin (Dst), and Cpm. [score:5]
miR-466 was discovered in a recent study to identify miRNAs that target the Prospero homeobox 1 (Prox1) gene, a known regulator of retinal neurogenesis. [score:4]
This filtering strategy allowed us to identify 2 genes (Ell2 and Entpd1) as well as 3 miRNAs (mir466, miR1187 and miR710) that are regulated by epigenetic factors and nuclear hormone receptors and are associated with AMD pathogenesis. [score:2]
[1 to 20 of 6 sentences]
4
[+] score: 24
Other miRNAs from this paper: mmu-mir-466a, mmu-mir-467a-1, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-548d-1, hsa-mir-548d-2, mmu-mir-669a-1, mmu-mir-669b, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-467b, mmu-mir-669c, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-467c, mmu-mir-467d, mmu-mir-466d, mmu-mir-467e, mmu-mir-466l, mmu-mir-669k, mmu-mir-669g, mmu-mir-669d, mmu-mir-466i, mmu-mir-669j, mmu-mir-669f, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-467f, mmu-mir-466j, mmu-mir-669e, mmu-mir-467g, mmu-mir-467h, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, mmu-mir-669l, mmu-mir-669m-1, mmu-mir-669m-2, mmu-mir-669o, mmu-mir-669n, hsa-mir-548q, mmu-mir-466m, mmu-mir-669d-2, mmu-mir-466o, mmu-mir-467a-2, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-467a-3, mmu-mir-466c-2, mmu-mir-669a-6, mmu-mir-467a-4, mmu-mir-466b-4, mmu-mir-669a-7, mmu-mir-467a-5, mmu-mir-466b-5, mmu-mir-669p-1, mmu-mir-467a-6, mmu-mir-669a-8, mmu-mir-669a-9, mmu-mir-467a-7, mmu-mir-466b-7, mmu-mir-669p-2, mmu-mir-467a-8, mmu-mir-669a-10, mmu-mir-467a-9, mmu-mir-669a-11, mmu-mir-467a-10, mmu-mir-669a-12, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, hsa-mir-548s, hsa-mir-466, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-548x, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, mmu-mir-466q, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, mmu-mir-466c-3, hsa-mir-548bc
The expressions of mmu-miR-466 and mmu-miR-467 markedly waved during the hair follicle cycling in mouse [50] and were downregulated in melanoma of mouse by curcumin diet [51]. [score:6]
hsa-miR-548, mmu-miR-466, and mmu-miR-467 have an enormous number of targets on IGs, which both have the role of inhibition of host immunity response. [score:5]
The mmu-miR-466 family and mmu-miR-467 family have predicted 1,704 target sites and 956 target sites, respectively, distributed on 375 and 310 IGs of the mouse. [score:5]
We found that the hsa-miR-548 family has the highest amount of target sites among the identified miRNAs in human and the mmu-miR-466 and mmu-miR-467 families are top two in the miRNAs list predicted in the mouse. [score:3]
Both of hsa-miRNA-548 and mmu-miR-466 and mmu-miR-467 can inhibit the host immunity response [54]. [score:3]
In this study, mmu-miR-466, mmu-miR-467, and mmu-miR-669 clusters have one core promoter region and transcriptional start site shared with the Sfmbt2 gene. [score:1]
And histone deacetylation and metabolic oxidative stress can induce the activity of mmu-miR-466 [52]. [score:1]
[1 to 20 of 7 sentences]
5
[+] score: 15
In NSCs, hyperglycemia increased the expression of Dcx (Doublecortin) and Pafah1b1 (Platelet activating factor acetyl hydrolase, isoform 1b, subunit 1) proteins concomitant with decreased expression of four microRNAs (mmu-miR-200a, mmu-miR-200b, mmu-miR-466a-3p and mmu-miR-466 d-3p) predicted to target these genes. [score:7]
miR-200 family has been reported to regulate olfactory neurogenesis in mouse and zebrafish mo dels [47] and the expression of few members of miR-466 family have been shown in mouse ocular tissue [48]. [score:4]
This study is the first to report the expression of miRNAs mmu-miR-200a, mmu-miR-200b, mmu-miR-466a-3p and mmu-miR-466 d-3p in NSCs obtained from mouse embryonic forebrain. [score:3]
We performed in situ hybridization of two representative miRNAs (mmu-miR-200b and mmu-miR-466d-3p) selected from each family of miRNA that are investigated in this study (mmu-miR-200 and mmu-miR-466 family) in unbiased manner to detect whether these miRNAs were expressed by NSCs. [score:1]
[1 to 20 of 4 sentences]
6
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-182, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, mmu-mir-297a-1, mmu-mir-297a-2, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-138-2, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-138-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, rno-mir-301a, rno-let-7d, rno-mir-344a-1, mmu-mir-344-1, rno-mir-346, mmu-mir-346, rno-mir-352, hsa-mir-181b-2, mmu-mir-10a, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-125b-1, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-362, mmu-mir-362, hsa-mir-369, hsa-mir-374a, mmu-mir-181b-2, hsa-mir-346, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-10a, rno-mir-15b, rno-mir-26b, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-34b, rno-mir-34c, rno-mir-34a, rno-mir-106b, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-138-2, rno-mir-138-1, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-181a-1, hsa-mir-449a, mmu-mir-449a, rno-mir-449a, mmu-mir-463, mmu-mir-466a, hsa-mir-483, hsa-mir-493, hsa-mir-181d, hsa-mir-499a, hsa-mir-504, mmu-mir-483, rno-mir-483, mmu-mir-369, rno-mir-493, rno-mir-369, rno-mir-374, hsa-mir-579, hsa-mir-582, hsa-mir-615, hsa-mir-652, hsa-mir-449b, rno-mir-499, hsa-mir-767, hsa-mir-449c, hsa-mir-762, mmu-mir-301b, mmu-mir-374b, mmu-mir-762, mmu-mir-344d-3, mmu-mir-344d-1, mmu-mir-673, mmu-mir-344d-2, mmu-mir-449c, mmu-mir-692-1, mmu-mir-692-2, mmu-mir-669b, mmu-mir-499, mmu-mir-652, mmu-mir-615, mmu-mir-804, mmu-mir-181d, mmu-mir-879, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-344-2, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-493, mmu-mir-504, mmu-mir-466d, mmu-mir-449b, hsa-mir-374b, hsa-mir-301b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-879, mmu-mir-582, rno-mir-181d, rno-mir-182, rno-mir-301b, rno-mir-463, rno-mir-673, rno-mir-652, mmu-mir-466l, mmu-mir-669k, mmu-mir-466i, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-1193, mmu-mir-767, rno-mir-362, rno-mir-504, rno-mir-582, rno-mir-615, mmu-mir-3080, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-344e, mmu-mir-344b, mmu-mir-344c, mmu-mir-344g, mmu-mir-344f, mmu-mir-374c, mmu-mir-466b-8, hsa-mir-466, hsa-mir-1193, rno-mir-449c, rno-mir-344b-2, rno-mir-466d, rno-mir-344a-2, rno-mir-1193, rno-mir-344b-1, hsa-mir-374c, hsa-mir-499b, mmu-mir-466q, mmu-mir-344h-1, mmu-mir-344h-2, mmu-mir-344i, rno-mir-344i, rno-mir-344g, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-692-3, rno-let-7g, rno-mir-15a, rno-mir-762, mmu-mir-466c-3, rno-mir-29c-2, rno-mir-29b-3, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
Of these miRNAs, 12 were upregulated (miR-34b, miR-138, miR-297a, miR-301, miR-449, miR-466, miR-493, miR-579, miR-582, miR. [score:4]
MiR-466 was the only miRNA that was upregulated both in lung and blood of mice bearing >10 microadenomas. [score:4]
The identity, fold-change variation, direction of alteration, and biological function of these miRNAs are reported in Table 2. In mice bearing adenomas, 5 miRNAs (miR-34b, miR-106a, miR-499, miR-466, and miR-493) were altered in the blood serum but not in lung. [score:2]
One miRNA only (miR-466) was altered in both body compartments of mice bearing >10 microadenomas in the lung fragment. [score:1]
[1 to 20 of 4 sentences]
7
[+] score: 11
Exosomes contain circulating microRNAs which can modify the expression of genes 15, 16 and we screened mir466, 455, 323 and 29b that can bind to the 3′ UTR region of MMP9 and downregulate its expression. [score:8]
Figure 6Expression of mir29b, mir455, mir323-5p and mir466. [score:3]
[1 to 20 of 2 sentences]
8
[+] score: 9
Other miRNAs from this paper: mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-27b, mmu-mir-126a, mmu-mir-127, mmu-mir-145a, mmu-mir-181a-2, mmu-mir-182, mmu-mir-199a-1, mmu-mir-122, mmu-mir-143, mmu-mir-298, mmu-let-7d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-23a, mmu-mir-27a, mmu-mir-31, mmu-mir-98, mmu-mir-181a-1, mmu-mir-199a-2, mmu-mir-181b-1, mmu-mir-379, mmu-mir-181b-2, mmu-mir-449a, mmu-mir-451a, mmu-mir-466a, mmu-mir-486a, mmu-mir-671, mmu-mir-669a-1, mmu-mir-669b, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-669c, mmu-mir-491, mmu-mir-700, mmu-mir-500, mmu-mir-18b, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-466d, mmu-mir-466l, mmu-mir-669k, mmu-mir-669g, mmu-mir-669d, mmu-mir-466i, mmu-mir-669j, mmu-mir-669f, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-669e, mmu-mir-669l, mmu-mir-669m-1, mmu-mir-669m-2, mmu-mir-669o, mmu-mir-669n, mmu-mir-466m, mmu-mir-669d-2, mmu-mir-466o, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-466c-2, mmu-mir-669a-6, mmu-mir-466b-4, mmu-mir-669a-7, mmu-mir-466b-5, mmu-mir-669p-1, mmu-mir-669a-8, mmu-mir-669a-9, mmu-mir-466b-7, mmu-mir-669p-2, mmu-mir-669a-10, mmu-mir-669a-11, mmu-mir-669a-12, mmu-mir-466p, mmu-mir-466n, mmu-mir-486b, mmu-mir-466b-8, mmu-mir-466q, mmu-mir-145b, mmu-let-7j, mmu-mir-451b, mmu-let-7k, mmu-mir-126b, mmu-mir-466c-3
miR-669 is involved in c-Myc expression through p53 [95], miR-500 regulates MET protooncogenes and affects NF-kB [96], miR-466 is involved in mammary tumor development, miR-466c is involved in tumor growth [95], miR-449a regulates breast cancer development and inhibits cell proliferation [71], [97], [98] and miR-Let7b plays a role in myeloid leukemia [99]. [score:9]
[1 to 20 of 1 sentences]
9
[+] score: 8
In this study, we also predicted targets of miRNAs, and found the targets of miR-10a miR-10b miR-414 and miR-466 in the HOX clusters (Additional file 9). [score:5]
Regarding targets of miRNAs in the tammar HOX clusters, valid miRNA hits to miR-10a, miR-10b, miR-414 and miR-466 were confirmed (details referred to Additional file 9). [score:3]
[1 to 20 of 2 sentences]
10
[+] score: 8
Other miRNAs from this paper: mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-130a, mmu-mir-186, mmu-mir-200b, mmu-mir-202, mmu-mir-30e, mmu-let-7d, mmu-mir-130b, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-192, mmu-mir-200a, mmu-mir-15a, mmu-mir-21a, mmu-mir-29a, mmu-mir-29c, mmu-mir-93, mmu-mir-19a, mmu-mir-200c, mmu-mir-29b-2, mmu-mir-19b-1, mmu-mir-466a, mmu-mir-467a-1, mmu-mir-669a-1, mmu-mir-669b, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-467b, mmu-mir-669c, mmu-mir-709, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-467c, mmu-mir-467d, mmu-mir-574, mmu-mir-466d, mmu-mir-467e, mmu-mir-466l, mmu-mir-669k, mmu-mir-669g, mmu-mir-669d, mmu-mir-466i, mmu-mir-669j, mmu-mir-669f, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-467f, mmu-mir-466j, mmu-mir-669e, mmu-mir-467g, mmu-mir-467h, mmu-mir-669l, mmu-mir-669m-1, mmu-mir-669m-2, mmu-mir-669o, mmu-mir-669n, mmu-mir-466m, mmu-mir-669d-2, mmu-mir-466o, mmu-mir-467a-2, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-467a-3, mmu-mir-466c-2, mmu-mir-669a-6, mmu-mir-467a-4, mmu-mir-466b-4, mmu-mir-669a-7, mmu-mir-467a-5, mmu-mir-466b-5, mmu-mir-669p-1, mmu-mir-467a-6, mmu-mir-669a-8, mmu-mir-669a-9, mmu-mir-467a-7, mmu-mir-466b-7, mmu-mir-669p-2, mmu-mir-467a-8, mmu-mir-669a-10, mmu-mir-467a-9, mmu-mir-669a-11, mmu-mir-467a-10, mmu-mir-669a-12, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, mmu-mir-466q, mmu-mir-21b, mmu-mir-130c, mmu-mir-21c, mmu-mir-30f, mmu-mir-466c-3
In particular, BMP5 mRNA is upregulated while the miR-466/467 cluster is downregulated. [score:7]
For example, miR-466, miR-669, and miR-467 were derived from a single microRNA cluster Chromosome 2 microRNA cluster (C2MC) which might play important roles in immune response [32]. [score:1]
[1 to 20 of 2 sentences]
11
[+] score: 8
The miR-466 family affects apoptosis regulation in mammalian cells and is a master regulator of several pathways associated with regulatory T cell development and function [61, 62]. [score:5]
Two miRNAs, miR-222-3p and miR-466 k, were differentially expressed. [score:3]
[1 to 20 of 2 sentences]
12
[+] score: 6
We verified by real-time quantitative PCR the expression levels of miR-466e-3p, miR-185-3p and miR-21-3p; both miR-466-e-3p and miR-21-3p were upregulated after high-fat diet and irradiation, respectively (Table S1). [score:6]
[1 to 20 of 1 sentences]
13
[+] score: 3
In the present study, we found that the miR-379∼329∼667∼410 cluster has 38 mir genes, while the miR-466∼467∼669 cluster, being one of the largest miRNA clusters in mouse genome, has 71 miRNA genes. [score:1]
The miR-466∼467∼669 cluster is one of the largest miRNA clusters in the mouse genome, containing 71 miRNA genes. [score:1]
Each clusters had at least 2 genes, with mir-466∼467∼669 cluster (cluster # 2) having 71 genes and mir-379∼410 cluster (cluster #7) having 38 genes. [score:1]
[1 to 20 of 3 sentences]
14
[+] score: 3
Among over-expressed miRNAs, e. g., miR-31, miR-96, and miR-92b, which are known to be involved in cancer progression, eight miRNAs (miR-466b/c/p, miR-674, miR-672, miR-1983, miR-3105, and miR-6539) have not been shown to play a role in breast cancer progression. [score:3]
[1 to 20 of 1 sentences]
15
[+] score: 3
For experimental confirmation of the expression pattern based on microarray testing, Q-PCR was performed for some genes (ABCC4 from temporal up-pattern, CYP3A11 from temporal down-pattern, and FOXA1 from non-pattern) and microRNAs (miR-23a-3p and miR-466b-3p). [score:3]
[1 to 20 of 1 sentences]
16
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-93, mmu-let-7g, mmu-let-7i, mmu-mir-126a, mmu-mir-302a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-126, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-93, hsa-mir-302a, mmu-mir-466a, hsa-mir-551b, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-626, hsa-mir-548d-1, hsa-mir-548d-2, mmu-mir-551b, mmu-mir-763, mmu-mir-680-2, mmu-mir-692-1, mmu-mir-327, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-466d, mmu-mir-466l, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-467g, hsa-mir-1233-1, hsa-mir-1234, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-1299, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-1255a, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-1268a, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-103b-2, hsa-mir-320d-2, hsa-mir-548q, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, hsa-mir-548s, hsa-mir-466, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-3176, hsa-mir-548w, hsa-mir-548x, mmu-mir-3471-1, hsa-mir-4281, hsa-mir-1302-11, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-1268b, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-3689c, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, mmu-mir-466q, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, mmu-let-7j, hsa-mir-548ay, hsa-mir-548az, mmu-let-7k, mmu-mir-126b, hsa-mir-548ba, hsa-mir-548bb, mmu-mir-466c-3, hsa-mir-548bc
We observed five categories: • The primary sequences of pre-miRNAs HSA-MIR-466, HSA-MIR-1233-1, HSA-MIR-3669, MMU-MIR-297A-6 and MMU-MIR-467g are similar to microsatellites (microsatellites are similar to tandem repeats of short sequence motifs (less than 10 nt)) [39]): HSA-MIR-466 contains microsatellites GU [n ]and AC [n]; HSA-MIR-1233-1 contains microsatellites AGGGC [n]; and MMU-MIR-467g is composed by microsatellite AU [n]. [score:1]
We observed five categories: • The primary sequences of pre-miRNAs HSA-MIR-466, HSA-MIR-1233-1, HSA-MIR-3669, MMU-MIR-297A-6 and MMU-MIR-467g are similar to microsatellites (microsatellites are similar to tandem repeats of short sequence motifs (less than 10 nt)) [39]): HSA-MIR-466 contains microsatellites GU [n ]and AC [n]; HSA-MIR-1233-1 contains microsatellites AGGGC [n]; and MMU-MIR-467g is composed by microsatellite AU [n]. [score:1]
[1 to 20 of 2 sentences]
17
[+] score: 2
In these mice, 5 miRNAs were altered in blood but not in lung (miR-34b, miR-106a, miR-449, miR-466, miR-493). [score:1]
One miRNA only (miR-466) was altered in both blood serum and lung of mice with a high yield of microadenomas. [score:1]
[1 to 20 of 2 sentences]
18
[+] score: 2
Similarly, miR-466-3c was regulated by two nearby loci on chromosome 10 (14–24 Mb, rs3712394 and 24–38 Mb, rs13480563). [score:2]
[1 to 20 of 1 sentences]
19
[+] score: 2
Other miRNAs from this paper: hsa-mir-25, hsa-mir-28, hsa-mir-95, mmu-mir-151, mmu-mir-290a, mmu-mir-297a-1, mmu-mir-297a-2, mmu-mir-130b, mmu-mir-340, mmu-mir-25, mmu-mir-28a, hsa-mir-130b, hsa-mir-367, hsa-mir-372, hsa-mir-378a, mmu-mir-378a, hsa-mir-340, hsa-mir-151a, mmu-mir-466a, mmu-mir-467a-1, hsa-mir-505, hsa-mir-506, mmu-mir-367, hsa-mir-92b, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-648, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-659, hsa-mir-421, hsa-mir-151b, hsa-mir-1271, hsa-mir-378d-2, mmu-mir-467b, mmu-mir-297b, mmu-mir-505, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-297c, mmu-mir-421, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-467c, mmu-mir-467d, mmu-mir-92b, mmu-mir-466d, hsa-mir-297, mmu-mir-467e, mmu-mir-466l, mmu-mir-669g, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-467f, mmu-mir-466j, mmu-mir-467g, mmu-mir-467h, mmu-mir-1195, hsa-mir-548e, hsa-mir-548j, hsa-mir-1285-1, hsa-mir-1285-2, hsa-mir-1289-1, hsa-mir-1289-2, hsa-mir-548k, hsa-mir-1299, hsa-mir-548l, hsa-mir-1302-1, hsa-mir-1302-2, hsa-mir-1302-3, hsa-mir-1302-4, hsa-mir-1302-5, hsa-mir-1302-6, hsa-mir-1302-7, hsa-mir-1302-8, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-1255a, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-1268a, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-1255b-1, hsa-mir-1255b-2, mmu-mir-1906-1, hsa-mir-1972-1, hsa-mir-548q, mmu-mir-466m, mmu-mir-466o, mmu-mir-467a-2, mmu-mir-467a-3, mmu-mir-466c-2, mmu-mir-467a-4, mmu-mir-466b-4, mmu-mir-467a-5, mmu-mir-466b-5, mmu-mir-467a-6, mmu-mir-467a-7, mmu-mir-466b-7, mmu-mir-467a-8, mmu-mir-467a-9, mmu-mir-467a-10, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, hsa-mir-3116-1, hsa-mir-3116-2, hsa-mir-3118-1, hsa-mir-3118-2, hsa-mir-3118-3, hsa-mir-548s, hsa-mir-378b, hsa-mir-466, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-3156-1, hsa-mir-3118-4, hsa-mir-3174, hsa-mir-3179-1, hsa-mir-3179-2, hsa-mir-3179-3, hsa-mir-548w, hsa-mir-3156-2, hsa-mir-3156-3, hsa-mir-548x, mmu-mir-3470a, mmu-mir-3470b, mmu-mir-3471-1, mmu-mir-3471-2, hsa-mir-378c, hsa-mir-1972-2, hsa-mir-1302-9, hsa-mir-1302-10, hsa-mir-1302-11, mmu-mir-1906-2, hsa-mir-3683, hsa-mir-3690-1, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-1268b, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, mmu-mir-28c, mmu-mir-378b, mmu-mir-28b, hsa-mir-548ao, hsa-mir-548ap, mmu-mir-466q, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, mmu-mir-378c, mmu-mir-378d, hsa-mir-548ay, hsa-mir-548az, hsa-mir-3690-2, mmu-mir-290b, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-3179-4, mmu-mir-466c-3, hsa-mir-548bc, mmu-mir-1271
Examples of this are the mir-297, mir-466, mir-467, mir-548 [16], mir-1302 [20], mir-1972, mir-3118 and mir-3179 families (which are all RrmiR families listed here) (Table S5). [score:1]
Three miRNA families that are the results of lineage-specific expansion were found in the mouse genome: the mir-466 and mir-467 families derived from simple repeats and the mir-297 family derived from SINE and LTR repetitive elements (Table S1 and Table S2). [score:1]
[1 to 20 of 2 sentences]
20
[+] score: 1
An exception might be the sequence containing has-mir-466 with (TATG)n and (CA)n microsatellites (Additional File 2 Table S4A). [score:1]
[1 to 20 of 1 sentences]
21
[+] score: 1
However, in sheep, the analyzed miRNA sites that are located in the 505 bp 3′ UTR of the ovine s-SCF (+) form belongs to the miRNA families of miR-27a/b, miR-194, miR-128, miR-370, and two sites for miR-132/212, miR-320/320abcd (Figure 9(a)) where as miR-669f/a/o-3p, miR-466b and miR828b are detected on the shorter 3′ UTR segment (144 bp) of ovine m-SCF (−) form (Figure 9(b)). [score:1]
[1 to 20 of 1 sentences]
22
[+] score: 1
Other miRNAs from this paper: mmu-mir-30a, mmu-mir-30b, mmu-mir-141, mmu-mir-151, mmu-mir-10b, mmu-mir-191, mmu-mir-143, mmu-mir-30e, mmu-mir-34c, mmu-mir-34b, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-21a, mmu-mir-10a, mmu-mir-139, mmu-mir-375, mmu-mir-196b, mmu-mir-465a, mmu-mir-466a, mmu-mir-467a-1, mmu-mir-669a-1, mmu-mir-669b, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-467b, mmu-mir-669c, mmu-mir-465b-1, mmu-mir-465b-2, mmu-mir-465c-1, mmu-mir-465c-2, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-467c, mmu-mir-467d, mmu-mir-466d, mmu-mir-208b, mmu-mir-467e, mmu-mir-466l, mmu-mir-669k, mmu-mir-669g, mmu-mir-669d, mmu-mir-466i, mmu-mir-669j, mmu-mir-669f, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-467f, mmu-mir-466j, mmu-mir-669e, mmu-mir-467g, mmu-mir-467h, mmu-mir-669l, mmu-mir-669m-1, mmu-mir-669m-2, mmu-mir-669o, mmu-mir-669n, mmu-mir-466m, mmu-mir-669d-2, mmu-mir-466o, mmu-mir-467a-2, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-467a-3, mmu-mir-466c-2, mmu-mir-669a-6, mmu-mir-467a-4, mmu-mir-466b-4, mmu-mir-669a-7, mmu-mir-467a-5, mmu-mir-466b-5, mmu-mir-669p-1, mmu-mir-467a-6, mmu-mir-669a-8, mmu-mir-669a-9, mmu-mir-467a-7, mmu-mir-466b-7, mmu-mir-669p-2, mmu-mir-467a-8, mmu-mir-669a-10, mmu-mir-467a-9, mmu-mir-669a-11, mmu-mir-467a-10, mmu-mir-669a-12, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, mmu-mir-466q, mmu-mir-6240, mmu-mir-30f, mmu-mir-465d, mmu-mir-466c-3
Prominent among these were members of the let7, miR-30, miR-465, miR-466, miR-467, and miR-669 clusters. [score:1]
[1 to 20 of 1 sentences]
23
[+] score: 1
miR-466 and miR-184 are reported to be closely related with corneal lymphangiogenesis. [score:1]
[1 to 20 of 1 sentences]
24
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-33a, hsa-mir-98, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-126a, mmu-mir-133a-1, mmu-mir-135a-1, mmu-mir-141, mmu-mir-194-1, mmu-mir-200b, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-203a, hsa-mir-211, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-200b, mmu-mir-300, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-141, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-21a, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-343, rno-mir-135b, mmu-mir-135b, hsa-mir-200c, mmu-mir-200c, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-33, mmu-mir-211, mmu-mir-29b-2, mmu-mir-135a-2, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-326, hsa-mir-135b, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-21, rno-mir-26b, rno-mir-27b, rno-mir-27a, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-33, rno-mir-98, rno-mir-126a, rno-mir-133a, rno-mir-135a, rno-mir-141, rno-mir-194-1, rno-mir-194-2, rno-mir-200c, rno-mir-200a, rno-mir-200b, rno-mir-203a, rno-mir-211, rno-mir-218a-2, rno-mir-218a-1, rno-mir-300, hsa-mir-429, mmu-mir-429, rno-mir-429, hsa-mir-485, hsa-mir-511, hsa-mir-532, mmu-mir-532, rno-mir-133b, mmu-mir-485, rno-mir-485, hsa-mir-33b, mmu-mir-702, mmu-mir-343, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, hsa-mir-300, mmu-mir-511, rno-mir-466b-1, rno-mir-466b-2, rno-mir-532, rno-mir-511, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-7, mmu-mir-466b-8, hsa-mir-3120, rno-mir-203b, rno-mir-3557, rno-mir-218b, rno-mir-3569, rno-mir-133c, rno-mir-702, rno-mir-3120, hsa-mir-203b, mmu-mir-344i, rno-mir-344i, rno-mir-6316, mmu-mir-133c, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-3569, rno-let-7g, rno-mir-29c-2, rno-mir-29b-3, rno-mir-466b-3, rno-mir-466b-4, mmu-mir-203b
Type of site Context+ Context Structure Energy Is experimental validated rno-miR-326-5p MIMAT0017028 3 8mer 7mer-m8 imperfect −0.442 −0.242 431 −65.97 TRUE rno-miR-485-5p MIMAT0003203 2 7mer-m8 −0.343 −0.372 290 −34.96 TRUE rno-miR-300-5p MIMAT0004743 1 8mer −0.338 −0.421 156 −15.16 TRUE rno-miR-702-5p MIMAT0017884 1 8mer −0.317 −0.274 142 −13.86 TRUE rno-miR-203b-3p MIMAT0017800 2 7mer-m8 −0.298 −0.421 295 −29.93 TRUE rno-miR-33-3p MIMAT0017104 2 8mer 7mer-m8 −0.297 −0.813 305 −22.7 TRUE rno-miR-466b-3p MIMAT0017285 1 8mer −0.295 −0.47 159 −15.26 TRUE rno-miR-532-5p MIMAT0005322 1 7mer-m8 −0.268 −0.302 151 −10.71 TRUE rno-miR-511-5p MIMAT0012829 1 7mer-m8 −0.268 −0.302 152 −10.37 TRUE rno-miR-343 MIMAT0000591 1 7mer-m8 −0.262 −0.24 140 −13.75 TRUE rno-miR-203a-3p MIMAT0000876 1 8mer −0.245 −0. [score:1]
[1 to 20 of 1 sentences]
25
[+] score: 1
From the following groups of miRNAs with identical sequence, only the first member is annotated in the heat-map: mmu-let-7a*/mmu-let-7c-2*; mmu-miR-466a-3p/mmu-miR-466b-3p/mmu-miR-466c-3p/mmu-miR-466e-3p; mmu-miR-467a*/mmu-miR-467d*; mmu-miR-297a*/mmu-miR-297c*/mmu-miR-297b-3p and mmu-miR-199a-3p/mmu-miR-199b. [score:1]
[1 to 20 of 1 sentences]
26
[+] score: 1
The well-studied miRNAs within this group included let-7 family (let-7c/d/f/k), miR-212 cluster (miR-212-3p and miR-132-3p/5p), miR-23a/b, miR-9-3p/5p, miR-411 clusters (miR-299a and miR-329) and miR-466 clusters (miR-466m-5p and miR-669f-5p) (Figure 2 and Table 1). [score:1]
[1 to 20 of 1 sentences]
27
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-15a, hsa-mir-18a, hsa-mir-33a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-mir-27b, mmu-mir-126a, mmu-mir-128-1, mmu-mir-140, mmu-mir-146a, mmu-mir-152, mmu-mir-155, mmu-mir-191, hsa-mir-10a, hsa-mir-211, hsa-mir-218-1, hsa-mir-218-2, mmu-mir-297a-1, mmu-mir-297a-2, hsa-mir-27b, hsa-mir-128-1, hsa-mir-140, hsa-mir-152, hsa-mir-191, hsa-mir-126, hsa-mir-146a, mmu-let-7a-1, mmu-let-7a-2, mmu-mir-15a, mmu-mir-18a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-342, hsa-mir-155, mmu-mir-107, mmu-mir-10a, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-33, mmu-mir-211, hsa-mir-374a, hsa-mir-342, gga-mir-33-1, gga-let-7a-3, gga-mir-155, gga-mir-18a, gga-mir-15a, gga-mir-218-1, gga-mir-103-2, gga-mir-107, gga-mir-128-1, gga-mir-140, gga-let-7a-1, gga-mir-146a, gga-mir-103-1, gga-mir-218-2, gga-mir-126, gga-let-7a-2, gga-mir-27b, mmu-mir-466a, mmu-mir-467a-1, hsa-mir-499a, hsa-mir-545, hsa-mir-593, hsa-mir-600, hsa-mir-33b, gga-mir-499, gga-mir-211, gga-mir-466, mmu-mir-675, mmu-mir-677, mmu-mir-467b, mmu-mir-297b, mmu-mir-499, mmu-mir-717, hsa-mir-675, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-297c, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-467c, mmu-mir-467d, mmu-mir-466d, hsa-mir-297, mmu-mir-467e, mmu-mir-466l, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-467f, mmu-mir-466j, mmu-mir-467g, mmu-mir-467h, hsa-mir-664a, hsa-mir-1306, hsa-mir-1307, gga-mir-1306, hsa-mir-103b-1, hsa-mir-103b-2, gga-mir-10a, mmu-mir-1306, mmu-mir-3064, mmu-mir-466m, mmu-mir-466o, mmu-mir-467a-2, mmu-mir-467a-3, mmu-mir-466c-2, mmu-mir-467a-4, mmu-mir-466b-4, mmu-mir-467a-5, mmu-mir-466b-5, mmu-mir-467a-6, mmu-mir-467a-7, mmu-mir-466b-7, mmu-mir-467a-8, mmu-mir-467a-9, mmu-mir-467a-10, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, hsa-mir-466, hsa-mir-3173, hsa-mir-3618, hsa-mir-3064, hsa-mir-499b, mmu-mir-466q, hsa-mir-664b, gga-mir-3064, mmu-mir-126b, gga-mir-33-2, mmu-mir-3618, mmu-mir-466c-3, gga-mir-191
The mouse host gene Sfmbt2 (Scm-like with four mbt domains 2), located on MMU2, was found to comprise the largest number of resident miRNA genes (n = 70) belonging to the mir-297, mir-466, and mir-467 gene families. [score:1]
[1 to 20 of 1 sentences]