sort by

8 publications mentioning zma-MIR1432

Open access articles that are associated with the species Zea mays and mention the gene name MIR1432. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 13
Other miRNAs from this paper: zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR162, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR171d, zma-MIR171f, zma-MIR394a, zma-MIR394b, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR396b, zma-MIR396a, zma-MIR399a, zma-MIR399c, zma-MIR399b, zma-MIR399d, zma-MIR399e, zma-MIR399f, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR319a, zma-MIR319c, zma-MIR319b, zma-MIR319d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR393a, zma-MIR408a, zma-MIR156k, zma-MIR160f, zma-MIR396c, zma-MIR396d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR393b, zma-MIR393c, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR397a, zma-MIR397b, zma-MIR398a, zma-MIR398b, zma-MIR399g, zma-MIR399h, zma-MIR399i, zma-MIR399j, zma-MIR408b, zma-MIR482, zma-MIR528a, zma-MIR528b, zma-MIR529, zma-MIR827, zma-MIR444a, zma-MIR444b
miR827 was predicted to target NAD(P) -binding and SPX (SYG1/Pho81/XPR1) proteins, whereas miR1432 was predicted to target Poly(ADP-ribose) polymerase, catalytic region functions and calcium binding EF hand domains. [score:5]
We noted that miR482 lacks an expression signature in any of the five tissues, while miR162 miR394, miR395, miR398, miR399, miR408, miR528 and miR1432 had low expression counts (less than 200 RPM). [score:5]
We also predicted potential targets of miRNA families not previously identified in maize (miR482, miR528, miR529, miR827 and miR1432). [score:3]
[1 to 20 of 3 sentences]
2
[+] score: 10
Other miRNAs from this paper: zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR171d, zma-MIR171f, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR396b, zma-MIR396a, zma-MIR399a, zma-MIR399c, zma-MIR399b, zma-MIR399d, zma-MIR399e, zma-MIR399f, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR319a, zma-MIR319c, zma-MIR319b, zma-MIR319d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR408a, zma-MIR156k, zma-MIR160f, zma-MIR396c, zma-MIR396d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR399g, zma-MIR399h, zma-MIR399i, zma-MIR399j, zma-MIR408b
In the first group of miRNAs, seven known miRNA families (miR1432, miR319, miR408, miR4366, miR8155, miR9773, and miR9774) were up-regulated in the maize library BP3–BN3. [score:4]
In rice infected with RBSDV at a later developmental stage, the expression of the miR1432 family increased in the leaves but decreased in the roots (Sun et al., 2014). [score:4]
miR1432 is thought to be involved in pollen development and male sterility (Yan et al., 2015) as well as in drought shock stress (Kantar et al., 2011) in rice. [score:2]
[1 to 20 of 3 sentences]
3
[+] score: 7
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR159a, ath-MIR160a, ath-MIR160b, ath-MIR160c, ath-MIR162a, ath-MIR162b, ath-MIR164a, ath-MIR164b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR167a, ath-MIR167b, ath-MIR169a, ath-MIR171a, ath-MIR172a, ath-MIR172b, ath-MIR159b, osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, ath-MIR167d, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR171b, ath-MIR171c, ath-MIR172c, ath-MIR172d, ath-MIR393a, ath-MIR393b, ath-MIR394a, ath-MIR394b, ath-MIR395a, ath-MIR395b, ath-MIR395c, ath-MIR395d, ath-MIR395e, ath-MIR395f, osa-MIR393a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, ath-MIR156g, ath-MIR156h, ath-MIR159c, ath-MIR164c, ath-MIR167c, ath-MIR172e, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR162, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR171d, zma-MIR171f, zma-MIR394a, zma-MIR394b, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR393a, zma-MIR156k, zma-MIR160f, osa-MIR528, osa-MIR529a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, ath-MIR827, osa-MIR529b, osa-MIR1432, osa-MIR169r, osa-MIR827, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR2275a, osa-MIR2275b, zma-MIR2118a, zma-MIR2118b, zma-MIR2118c, zma-MIR2118d, zma-MIR2118e, zma-MIR2118f, zma-MIR2118g, zma-MIR2275a, zma-MIR2275b, zma-MIR2275c, zma-MIR2275d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR393b, zma-MIR393c, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR482, zma-MIR528a, zma-MIR528b, zma-MIR529, zma-MIR827, osa-MIR395x, osa-MIR395y, osa-MIR2275c, osa-MIR2275d, ath-MIR156i, ath-MIR156j
Other conserved miRNA targets includes F-box protein (miRNA393, miRNA394), ATP sulfurylase (miRNA395), CCHC type zinc finger protein (miRNA482), NAD(P) -binding protein (miRNA827), and Poly(ADP-ribose) polymerase (miRNA1432), all of them are known to play roles in the expression control of genes involved in regulation of metabolic processes. [score:6]
The largest miRNA family size identified was miR166 that consisted of 14 members and miR156, miR169 and miR167 possessed 12, 12 and 10 members, respectively; whereas other miRNA families such as miR162, miR529, miR827 and miR1432 had only one member detected in this period. [score:1]
[1 to 20 of 2 sentences]
4
[+] score: 4
miR166 consisted of 14 members, miR156 and miR167 had 12 and 10 members, respectively, and miR162, miR529, miR827 and miR1432 had only one member. [score:1]
In the identified miRNA families (Fig 2), miR166 consisted of 14 members, miR156 and miR167 had 12 and 10 members, respectively, and miR162, miR529, miR827 and miR1432 had only one member. [score:1]
The least abundant miRNA families were miR160, miR394, miR529 and miR1432. [score:1]
0164026.g002 Fig 2 miR166 consisted of 14 members, miR156 and miR167 had 12 and 10 members, respectively, and miR162, miR529, miR827 and miR1432 had only one member. [score:1]
[1 to 20 of 4 sentences]
5
[+] score: 4
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR171a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, osa-MIR390, osa-MIR444a, zma-MIR171d, zma-MIR171f, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR408a, zma-MIR156k, zma-MIR160f, osa-MIR528, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR1432, osa-MIR827, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR2275a, osa-MIR2275b, zma-MIR2118a, zma-MIR2118b, zma-MIR2118c, zma-MIR2118d, zma-MIR2118e, zma-MIR2118f, zma-MIR2118g, zma-MIR2275a, zma-MIR2275b, zma-MIR2275c, zma-MIR2275d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR390a, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR408b, zma-MIR528a, zma-MIR528b, zma-MIR827, zma-MIR390b, osa-MIR395x, osa-MIR395y, osa-MIR2275c, osa-MIR2275d, zma-MIR444a, osa-MIR6251
miR1432 was predicted to target calmodulin -binding protein (CaMBP) and EF-hand protein in rice [36]. [score:3]
No sequence similarity was detected between miR1432 (CUCAGGAGAGAUGACACCGAC) and os_03_07 (AAUGACUUACAUUGUGGAACGGAG) mature sequences. [score:1]
[1 to 20 of 2 sentences]
6
[+] score: 1
seedlings which revealed MIR168a and b, MIR169c, d, i, j, m, q, and r, MIR159f, MIR397b, MIR156d, k and l, and MIR1432 (Table 2). [score:1]
[1 to 20 of 1 sentences]
7
[+] score: 1
Other miRNAs from this paper: zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR162, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR394a, zma-MIR394b, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR399a, zma-MIR399c, zma-MIR399b, zma-MIR399d, zma-MIR399e, zma-MIR399f, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR319a, zma-MIR319c, zma-MIR319b, zma-MIR319d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR393a, zma-MIR408a, zma-MIR156k, zma-MIR160f, zma-MIR2118a, zma-MIR2118b, zma-MIR2118c, zma-MIR2118d, zma-MIR2118e, zma-MIR2118f, zma-MIR2118g, zma-MIR2275a, zma-MIR2275b, zma-MIR2275c, zma-MIR2275d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR393b, zma-MIR393c, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR397a, zma-MIR397b, zma-MIR398a, zma-MIR398b, zma-MIR399g, zma-MIR399h, zma-MIR399i, zma-MIR399j, zma-MIR408b, zma-MIR482, zma-MIR528a, zma-MIR528b, zma-MIR529, zma-MIR827, zma-MIR444a, zma-MIR444b
The largest miRNA family size identified was miR166 that consisted of 14 members and miR156/157, miR167 and miR169 possessed 12, 10 and 9 members, respectively; whereas miR162, miR529, miR827 and miR1432 had only one member detected in the maize seeds (Figure 4). [score:1]
[1 to 20 of 1 sentences]
8
[+] score: 1
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR171a, osa-MIR393a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR156k, osa-MIR156l, osa-MIR166k, osa-MIR166l, osa-MIR168a, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR166m, osa-MIR166j, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR396b, zma-MIR396a, zma-MIR156j, zma-MIR166k, zma-MIR166j, zma-MIR168a, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR393a, zma-MIR408a, zma-MIR156k, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR1432, zma-MIR156l, zma-MIR166n, zma-MIR393b, zma-MIR393c, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR408b, zma-MIR482, osa-MIR395x, osa-MIR395y
Except for zma-miR393, zma-miR1432, zma-miR408, zma-miR482 and zma-miR395, 23 of 28 known maize miRNA families had members detected in at least one of the four sequenced libraries. [score:1]
[1 to 20 of 1 sentences]