sort by

13 publications mentioning ssc-mir-196b-1

Open access articles that are associated with the species Sus scrofa and mention the gene name mir-196b-1. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 65
Based on our results, we speculate that the α-(1, 2) fucosyltransferase 2 gene (FUT2) and Discs, large homolog 5 (DLG5) genes were the targets of down-regulated ssc-miR-218-3p, the MUC4 gene was the target of down-regulated ssc-miR-136, MyD88 was the target of up-regulated ssc-miR-499-5p, LBP and Toll-like receptor (TLR4) genes were the target of up-regulated ssc-miR-196b. [score:21]
Based on our results, we speculate that the α-(1, 2) fucosyltransferase 2 gene (FUT2) and Discs, large homolog 5 (DLG5) genes were the targets of down-regulated ssc-miR-218-3p, the MUC4 gene was the target of down-regulated ssc-miR-136, MyD88 was the target of up-regulated ssc-miR-499-5p, LBP and Toll-like receptor (TLR4) genes were the target of up-regulated ssc-miR-196b. [score:21]
Interestingly, RT-qPCR showed that ssc-miR-136 and ssc-miR-218-3p were significantly up-regulated in F18-sensitive piglets (P < 0.05), and ssc-miR-196b and ssc-miR-499-5p were significantly up-regulated in F18-resistant piglets (P < 0.05). [score:7]
In the present study, RT-qPCR showed that the expression of miR-136, miR-218-3p, miR-196b and miR-499-5p were significantly up- or down-regulated between F18-sensitive and -resistant piglets. [score:6]
Previous studies have shown that above miRNAs (miR-136, miR-218-3p, miR-196b and miR-499-5p) indeed play roles in the development and regulation of human disease [32– 35]. [score:5]
Stem-loop RT-qPCR showed that miR-136, miR-196b, miR-499-5p and miR-218-3p significantly expressed in intestinal tissue (p < 0.05). [score:3]
In conclusion, we initially identified miR-196b, miR-499-5p and miR-218-3p as candidate miRNAs involved in E. coli F18 infection by miRNAs sequencing and qRT-PCR validation. [score:1]
E. coli F18-resistant group E. coli F18-sensitive group P-value ssc-miR-499-5p MIMAT0013877 1.397±0.680 0.814±0.154 0.041* ssc-miR-676-5p MIMAT0017382 0.808±0.408 1.538±0.727 0.163 ssc-miR-432-3p MIMAT0017384 0.649±0.443 1.901±0.553 0.215 ssc-miR-196b MIMAT0013923 2.275±0.991 0.478±0.079 0.036* ssc-miR-421-5p MIMAT0017970 2.370±1.109 0.467±0.055 0.127 ssc-miR-202-5p MIMAT0013948 0.815±0.508 1.404±0.044 0.133 ssc-miR-885-3p MIMAT0013903 0.593±0. [score:1]
[1 to 20 of 8 sentences]
2
[+] score: 30
As examples, the liver-specific miR-122 promotes the replication of hepatitis C virus (HCV) [17], [18], while miR-196, miR-199, miR-296, miR-351, miR-431 and miR-448 inhibit HCV genome propagation [19], [20]; miR-32 effectively restricts the accumulation of primate foamy virus type 1 (PFV-1) in human cells [21]; miR-323, miR-491 and miR-654 inhibit the replication of the H1N1 influenza A virus by binding to the viral PB1 gene [22]; miR-28, miR-125b, miR-150, miR-223 and miR-382 target the 3′ end of human immunodeficiency virus (HIV) mRNA, thereby restricting HIV production [23]; miR-199a-3p and miR-210 limit the hepatitis B virus (HBV) surface antigen and polymerase production by degrading and/or inhibiting translation of viral mRNAs encoding these proteins [24]; overexpression of miR-24 and miR-93 suppresses vesicular stomatitis virus (VSV) replication through targeting the viral genes encoding RNA -dependent RNA polymerase (L protein) and phosphoprotein (P protein), respectively [25]; in macrophages, upregulation of miR-155 suppresses VSV replication, while inhibition of miR-155 had the opposite effect. [score:24]
To screen the potential miRNAs which can reduce PRRSV replication, the mimics or inhibitors of 10 miRNAs (Table S1), including miR-24, miR-93, miR-122, miR-125b, miR-146a, miR-155, miR-181, miR-196, miR-351, and miR-365, were chosen and synthetized. [score:3]
The mimics and inhibitors of miR-24, miR-93, miR-122, miR-125b, miR-146a, miR-155, miR-181, miR-196, miR-351, and miR-365 (shown in Table S1) were obtained from GenePharma (Shanghai, China). [score:3]
[1 to 20 of 3 sentences]
3
[+] score: 18
It has been established that miRNAs can target specific genes [23]; in the present study, let-7c, let-7 g, miR-18a, miR-196b, and miR-9 targeted MAP3K7, and miR-196b and miR-19b targeted dipeptidyl-peptidase 8 (DPP8), suggesting that cellular miRNAs play a key role in regulating gene expression in response to PPV infection. [score:10]
Among them, let-7 g, miR-17-5p, miR-17-3p, miR-20a, miR-181a, miR-16, miR-146b, miR-10b, and miR-155-5p were upregulated; let-7c, miR-122, miR-18a, miR-19a, miR-19b, miR-196b, miR-21, and miR-9 were downregulated. [score:7]
Many immune-related miRNAs have been identified in innate and adaptive immune systems, including the miR-17—92 cluster, miR-221, miR-10, miR-196b, miR-126, miR-155, miR-150; miR-181a, miR-326, miR-142-3p, miR-424, miR-21, miR-106a, miR-223, miR-146; the let-7 family, miR-9, and miR-34 [6]. [score:1]
[1 to 20 of 3 sentences]
4
[+] score: 10
ADIPOR2 is targeted by the downregulated miRNAs miR-181d, miR-92a, miR-204 and miR-196b-5p. [score:6]
MiR-204, miR-148a, miR-30a, miR-196b, and miR-17a were downregulated with fold changes of < -1.5 and p values < 0.05. [score:4]
[1 to 20 of 2 sentences]
5
[+] score: 8
In addition, miR-196 was found to be involved in regulation of axolotls tail regeneration [17], immunology, inflammation and virus defense [18, 19]. [score:2]
Most miRNAs are well conserved in evolution, including mir-196 family, which are conserved and localized within the Hox gene clusters among vertebrates [33, 34]. [score:1]
Among the precursors, mir-196a-1 and mir-196a-2 share the same functional mature sequence miR-196a, whereas mir-196b-1 and mir-196b-2 have two mature sequences: miR-196b-3p and miR-196b-5p (Table 2) [36, 37] In addition, the same mature sequences of miR-196a from the miRBase database were observed within Homo sapiens, Mus musculus and Sus scrofa, suggesting miR-196a was highly conserved across species and may play similar roles within the species mentioned above. [score:1]
miRNAs Gene Location Mature Sequences ssc-mir-196a-1 Chromosome 12 (24,834,774-24,838,853) UAGGUAGUUUCAUGUUGUUGGG ssc-mir-196a-2 Chromosome 5 (19,652,956-19,657,062) UAGGUAGUUUCAUGUUGUUGGG ssc-mir-196b-1 Chromosome 18 (49,834,543-49,838,622) UAGGUAGUUUCCUGUUGUUGGG CGACAGCACGACACUGCCUUCA ssc-mir-196b-2 Chromosome 18 (50,035,507-50,039,584) UAGGUAGUUUCCUGUUGUUGGG CGACAGCACGACACUGCCUUCA The mature sequences of the ssc-mir-196a-1, ssc--mir-196a-2, ssc-mir-196b-1 and ssc-mir-196b-2 were acquired from the miRBase sequence database. [score:1]
Sehm T. Sachse C. Frenzel C. Echeverri K. Mir-196 is an essential early-stage regulator of tail regeneration, upstream of key spinal cord patterning events Dev. [score:1]
Chen C. Zhang Y. Zhang L. Weakley S. M. Yao Q. Microrna-196: Critical roles and clinical applications in development and cancer J. Cell. [score:1]
In Sus Scrofa, four mir-196 precursor sequences have been identified including mir-196a-1, mir-196a-2, mir-196b-1 and ir-196b-2 [15, 16, 35]. [score:1]
[1 to 20 of 7 sentences]
6
[+] score: 6
Other miRNAs from this paper: mmu-mir-1a-1, mmu-mir-127, mmu-mir-134, mmu-mir-136, mmu-mir-154, mmu-mir-181a-2, mmu-mir-143, mmu-mir-196a-1, mmu-mir-196a-2, mmu-mir-21a, rno-mir-329, mmu-mir-329, mmu-mir-1a-2, mmu-mir-181a-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-375, mmu-mir-379, mmu-mir-181b-2, rno-mir-21, rno-mir-127, rno-mir-134, rno-mir-136, rno-mir-143, rno-mir-154, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-196a, rno-mir-181a-1, mmu-mir-196b, rno-mir-196b-1, mmu-mir-412, mmu-mir-370, oar-mir-431, oar-mir-127, oar-mir-432, oar-mir-136, mmu-mir-431, mmu-mir-433, rno-mir-431, rno-mir-433, ssc-mir-181b-2, ssc-mir-181c, ssc-mir-136, ssc-mir-196a-2, ssc-mir-21, rno-mir-370, rno-mir-412, rno-mir-1, mmu-mir-485, mmu-mir-541, rno-mir-541, rno-mir-493, rno-mir-379, rno-mir-485, mmu-mir-668, bta-mir-21, bta-mir-181a-2, bta-mir-127, bta-mir-181b-2, bta-mir-181c, mmu-mir-181d, mmu-mir-493, rno-mir-181d, rno-mir-196c, rno-mir-375, mmu-mir-1b, bta-mir-1-2, bta-mir-1-1, bta-mir-134, bta-mir-136, bta-mir-143, bta-mir-154a, bta-mir-181d, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-329a, bta-mir-329b, bta-mir-370, bta-mir-375, bta-mir-379, bta-mir-412, bta-mir-431, bta-mir-432, bta-mir-433, bta-mir-485, bta-mir-493, bta-mir-541, bta-mir-181a-1, bta-mir-181b-1, ssc-mir-1, ssc-mir-181a-1, mmu-mir-432, rno-mir-668, ssc-mir-143, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-127, ssc-mir-432, oar-mir-21, oar-mir-181a-1, oar-mir-493, oar-mir-433, oar-mir-370, oar-mir-379, oar-mir-329b, oar-mir-329a, oar-mir-134, oar-mir-668, oar-mir-485, oar-mir-154a, oar-mir-154b, oar-mir-541, oar-mir-412, mmu-mir-21b, mmu-mir-21c, ssc-mir-196a-1, ssc-mir-196b-2, ssc-mir-370, ssc-mir-493, bta-mir-154c, bta-mir-154b, oar-mir-143, oar-mir-181a-2, chi-mir-1, chi-mir-127, chi-mir-134, chi-mir-136, chi-mir-143, chi-mir-154a, chi-mir-154b, chi-mir-181b, chi-mir-181c, chi-mir-181d, chi-mir-196a, chi-mir-196b, chi-mir-21, chi-mir-329a, chi-mir-329b, chi-mir-379, chi-mir-412, chi-mir-432, chi-mir-433, chi-mir-485, chi-mir-493, rno-mir-196b-2, bta-mir-668, ssc-mir-375
For example, miR-273 and the lys-6 miRNA have been shown to be involved in the development of the nervous system in nematode worm [3]; miR-430 was reported to regulate the brain development of zebrafish [4]; miR-181 controlled the differentiation of mammalian blood cell to B cells [5]; miR-375 regulated mammalian islet cell growth and insulin secretion [6]; miR-143 played a role in adipocyte differentiation [7]; miR-196 was found to be involved in the formation of mammalian limbs [8]; and miR-1 was implicated in cardiac development [9]. [score:6]
[1 to 20 of 1 sentences]
7
[+] score: 4
As presented in Table 2, one class showed 100-fold greater levels of expression at E90 compared to D100, which included ssc-miR-126, ssc-miR-143-3p, ssc-miR-127, ssc-miR-148a, ssc-miR-196b-5p, and ssc-miR-369; another class exhibited expression levels of were slightly lower than 100-fold, which included ssc-miR-542-3p, ssc-miR-99b, ssc-miR-378, ssc-miR-30a-5p, ssc-miR-10b, and ssc-miR-21. [score:4]
[1 to 20 of 1 sentences]
8
[+] score: 2
A typical example is miR-196, which can direct the cleavage of HOXB8 mRNA in mouse embryos [8]. [score:2]
[1 to 20 of 1 sentences]
9
[+] score: 2
A study by Liu et al. found that miR-196b-5p could influence porcine adipogenesis in muscle through the adipocytokine signalling pathway [41]. [score:1]
miR-145-5p (miR-145), miR-146a-5p, miR-183, miR-196b-5p, and miR-224 were associated with adipogenesis in mammals. [score:1]
[1 to 20 of 2 sentences]
10
[+] score: 1
On the other hand, one of the known human mir-196 paralogs is located in the 5'UTR of a HoxA9 transcript [54]. [score:1]
[1 to 20 of 1 sentences]
11
[+] score: 1
Other miRNAs from this paper: ssc-mir-122, ssc-mir-135-1, ssc-mir-135-2, ssc-mir-148a, ssc-mir-19a, ssc-mir-20a, ssc-mir-224, ssc-mir-24-1, ssc-mir-323, ssc-mir-140, ssc-mir-183, ssc-mir-214, ssc-mir-27a, ssc-mir-325, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-136, ssc-mir-153, ssc-mir-18a, ssc-mir-186, ssc-mir-196a-2, ssc-mir-204, ssc-mir-21, bta-mir-18b, bta-let-7f-2, bta-mir-101-2, bta-mir-103-1, bta-mir-148a, bta-mir-18a, bta-mir-20a, bta-mir-21, bta-mir-221, bta-mir-27a, bta-mir-27b, bta-mir-107, bta-mir-140, bta-mir-20b, bta-mir-215, bta-let-7d, bta-mir-17, bta-mir-186, bta-mir-199b, bta-mir-210, bta-mir-214, bta-mir-450a-2, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-15a, bta-mir-19a, bta-mir-204, ssc-mir-15a, ssc-mir-17, ssc-mir-199b, ssc-mir-210, ssc-mir-221, bta-mir-101-1, bta-mir-133a-2, bta-mir-133a-1, bta-mir-135a-2, bta-mir-135a-1, bta-mir-135b, bta-mir-136, bta-mir-146b, bta-mir-153-1, bta-mir-153-2, bta-mir-183, bta-mir-24-1, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-224, bta-mir-323, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-450a, ssc-mir-146b, ssc-mir-215, bta-mir-1343, bta-mir-2320, bta-mir-2326, bta-mir-2366, bta-mir-2411, bta-mir-2483, bta-mir-450a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-103-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-450b, ssc-mir-450c, ssc-mir-133a-2, ssc-let-7a-2, ssc-mir-18b, ssc-mir-1343, ssc-mir-2320, bta-mir-450b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-196a-1, ssc-mir-196b-2, ssc-mir-2366-1, ssc-mir-2366-2, ssc-mir-2411, ssc-mir-2483
Moreover, published report showed that miR-196, miR-214, miR-199b, miR-186, miR-101 and miR-27a were related to bovine backfat thickness [36]. [score:1]
[1 to 20 of 1 sentences]
12
[+] score: 1
Other miRNAs from this paper: hsa-mir-17, hsa-mir-28, hsa-mir-223, hsa-mir-127, hsa-mir-188, hsa-mir-194-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-30e, hsa-mir-362, hsa-mir-363, hsa-mir-367, hsa-mir-379, hsa-mir-196b, hsa-mir-450a-1, hsa-mir-431, ssc-mir-28, hsa-mir-493, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-500a, hsa-mir-501, hsa-mir-502, hsa-mir-450a-2, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-506, hsa-mir-508, hsa-mir-509-1, hsa-mir-532, hsa-mir-615, hsa-mir-660, bta-mir-127, bta-mir-30e, bta-mir-17, bta-mir-450a-2, bta-mir-532, bta-mir-363, bta-mir-660, hsa-mir-891a, hsa-mir-892a, hsa-mir-509-2, hsa-mir-450b, hsa-mir-892b, hsa-mir-708, hsa-mir-509-3, hsa-mir-1285-1, hsa-mir-1285-2, hsa-mir-1248, ssc-mir-17, bta-mir-155, bta-mir-188, bta-mir-194-2, bta-mir-196b, bta-mir-223, bta-mir-28, bta-mir-362, bta-mir-367, bta-mir-379, bta-mir-431, bta-mir-493, bta-mir-500, bta-mir-502a-1, bta-mir-502a-2, bta-mir-502b, bta-mir-615, bta-mir-708, bta-mir-1248-1, bta-mir-1248-2, ssc-mir-450a, bta-mir-2320, bta-mir-1388, bta-mir-194-1, bta-mir-450a-1, eca-mir-30e, eca-mir-367, eca-mir-684, eca-mir-196b, eca-mir-615, eca-mir-708, eca-mir-194-1, eca-mir-493a, eca-mir-17, eca-mir-1248, eca-mir-28, eca-mir-127, eca-mir-379, eca-mir-431, eca-mir-493b, eca-mir-155, eca-mir-194-2, eca-mir-188, eca-mir-223, eca-mir-362, eca-mir-363, eca-mir-450a, eca-mir-450b, eca-mir-450c, eca-mir-500-1, eca-mir-500-2, eca-mir-501, eca-mir-502, eca-mir-508, eca-mir-509a, eca-mir-532, eca-mir-660, ssc-mir-30e, ssc-mir-450b, ssc-mir-127, ssc-mir-532, ssc-mir-708, ssc-mir-1285, ssc-mir-500, hsa-mir-514b, ssc-mir-363-1, ssc-mir-450c, hsa-mir-500b, ssc-mir-194b, ssc-mir-155, ssc-mir-362, bta-mir-3601, ssc-mir-615, ssc-mir-2320, bta-mir-450b, ssc-mir-194a, ssc-mir-196b-2, ssc-mir-363-2, ssc-mir-493, hsa-mir-892c, eca-mir-1388, eca-mir-514b, eca-mir-506a, eca-mir-509b, bta-mir-194b, ssc-mir-1388, ssc-mir-223, ssc-mir-660, bta-mir-194b-2, bta-mir-1949
Sometimes these duplicated annotations were found twice on the same chromosome in close proximity (for example mir-196b twice on the same strand, and both mir-615 and mir-194 twice, once on each strand) and sometimes they were found both on the assembled chromosomes and within the unplaced contigs (for example mir-127, mir-155). [score:1]
[1 to 20 of 1 sentences]
13
[+] score: 1
Matching of the miRNA’s nt 13–17 can compensate for a single-nucleotide bulge or mismatch in the seed region, as illustrated by the experimentally validated let-7 sites in LIN41 [34] and the miR-196 site in HOXB8 [35]. [score:1]
[1 to 20 of 1 sentences]