sort by

24 publications mentioning bta-mir-378-2

Open access articles that are associated with the species Bos taurus and mention the gene name mir-378-2. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 69
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-21, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-28, hsa-mir-30a, hsa-mir-96, hsa-mir-98, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30d, hsa-mir-34a, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-23b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-194-1, hsa-mir-194-2, hsa-mir-200a, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-342, hsa-mir-148b, hsa-mir-338, hsa-mir-335, hsa-mir-196b, hsa-mir-484, hsa-mir-486-1, hsa-mir-1271, hsa-mir-378d-2, bta-mir-26a-2, bta-mir-103-1, bta-mir-148a, bta-mir-21, bta-mir-27a, bta-mir-30d, bta-mir-484, bta-mir-99a, bta-mir-125a, bta-mir-125b-1, bta-mir-145, bta-mir-199a-1, bta-mir-27b, bta-mir-98, bta-mir-148b, bta-mir-200a, bta-mir-30a, bta-let-7a-1, bta-mir-342, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-125b-2, bta-mir-34a, bta-mir-99b, hsa-mir-885, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-143, bta-mir-152, bta-mir-16a, bta-mir-194-2, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-199a-2, bta-mir-26a-1, bta-mir-28, bta-mir-335, bta-mir-338, bta-mir-378-1, bta-mir-486, bta-mir-885, bta-mir-96, bta-mir-1271, bta-mir-2299, bta-mir-199c, bta-mir-1388, bta-mir-194-1, hsa-mir-378b, bta-mir-3431, hsa-mir-378c, hsa-mir-4286, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, bta-mir-4286-1, bta-mir-4286-2, hsa-mir-378j, bta-mir-378b, bta-mir-378c, hsa-mir-486-2, bta-mir-378d, bta-mir-194b, bta-mir-194b-2
Our analysis indicates that, about 3594 genes could be targeted by the eleven up-regulated miRNAs (bta-199a-3p, miR-98, miR-378, miR-21-5p, miR-148b, miR-4286, miR-885, miR-196a, miR-23b-3p, bta-miR-199c and miR-3431) whereas 1163 genes could be targeted by the three down-regulated miRNAs (bta-miR-335, miR-200a and bta-miR-2299-5p) in linseed oil -treated cows. [score:11]
FADS2, which cause desaturation of FAs is a direct target of bta-miR-98a (IPA knowledge base) while miR-378 can regulate adipocyte differentiation by directly targeting PPARγ and C/EBPα (CCAAT/enhancer -binding protein α), which promote lipogenesis stimulation and increase lipid droplet size in developing adipocytes when overexpressed [69]. [score:10]
Seven miRNAs including six up-regulated (bta-miR-199c, miR-199a-3p, miR-98, miR-378, miR-148b and miR-21-5p) and one down-regulated (bta-miR-200a) were found to be regulated (P < 0.05) by both treatments, and thus considered core differentially expressed (DE) miRNAs. [score:9]
The expression of seven miRNAs including six up-regulated (bta-miR-199c, miR-199a-3p, miR-98, miR-378, miR-148b and miR-21-5p) and one down-regulated (bta-miR-200a) were significantly affected by both treatments. [score:9]
Out of this number, 11 were up-regulated (bta-miR-4286, miR-885, miR-199c, miR-199a-3p, miR-3431, miR-98, miR-196a, miR-378, miR-23b-3p, miR-148b and miR-21-5p) while only 3 were down-regulated (miR-200a, miR-335 and miR-2299-5p) (Table  2). [score:7]
Seven of the DE miRNAs by safflower oil treatment (6 up-regulated: bta-miR-199c, miR-199a-3p, miR-98, miR-378, miR-148b, miR-21-5p; one down-regulated: bta-miR-200a) were also significantly affected by linseed oil supplementation. [score:7]
When compared with the control period (day-14), we identified a total of 22 DE miRNAs at day+28 including 10 up-regulated (bta-miR-199c, miR-199a-3p, miR-98, miR-378, miR-21-5p, miR-148b, miR-34a, miR-152, miR-16a, and miR-28) and 12 down-regulated (bta-miR-200a, miR-145, miR-99a-5p, miR-125b, miR-99b, miR-125a, miR-96, miR-484, miR-1388-5p, miR-342, miR-486 and miR-1271) (Table  2). [score:6]
Quantitative RT-PCR was used to validate the expression of select differentially expressed miRNAs (bta-miR-199a-3p, miR-378, miR-34a and miR-98). [score:5]
Real-time quantitative PCR (qPCR) was used to validate the expression levels of selected DE miRNAs (bta-miR-199a-3p, miR-34a, miR-378 and miR-98) identified in this study (Fig.   5). [score:3]
For example, bta-miR-199a and bta-miR-378 were differentially expressed at day+28 compared with day-14 in both treatments (P < 0.05) after RNA-sequencing and confirmed by qPCR. [score:2]
[1 to 20 of 10 sentences]
2
[+] score: 45
Since miRNA-378 can also target many other genes, future studies on the relationships of miRNA target genes and how the network of these target genes could impact on white adipose tissue development will supply a comprehensive view of the molecular mechanisms of fat formation, a very complicated process in beef cattle. [score:8]
Among the backfat thicknessassociated miRNAs, eight were DE miRNAs identified above, including two up-regulated miRNAs (miR-378, -196a) and six down-regulated miRNAs (miR-151-5p, -151-3p, -214, -186, -142-5p and -93) (Table 1). [score:7]
Of these 15 DE miRNAs, seven (miR-378, -143, -760, -98, -196a, -196b and -107) were identified as highly expressed in the tissue (> 1.34-fold) from high backfat thickness animals, whereas the remaining eight (miR-93, -151-5p, -214, -151-3p, -199a-3p, -191, -142-5p and -186) were expressed at a higher level in tissue from the low backfat thickness animals (Table 1). [score:5]
uk/enright-srv/microcosm/htdocs/targets/v5/ with miR-378 identified 816 potential target genes. [score:5]
The most differentially expressed miRNA (miR-378) was shown to have the strongest correlation with backfat thickness (r = 0.72). [score:3]
Therefore, we speculate that miR-378 may promote bovine adipogenesis in white adipose tissue through targeting MAPK1 and PPARγ (Figure 3). [score:3]
A. Potential target of miR-378 was predicted in the 3' UTR of MAPK1 (Ensembl ID and position are listed). [score:3]
The most differentially expressed miRNA was miR-378 with a 1.99-fold increase in high backfat thickness tissues, suggesting that this miRNA may have a role in adipogenesis and/or lipid deposition in bovine backfat tissues. [score:3]
The miRNA most differentially expressed and the most strongly associated with backfat thickness was miR-378, with a 1.99-fold increase in high backfat thickness tissues (r = 0.72). [score:3]
B. Regulation pathway of miR-378 in adipogenesis. [score:2]
MiRNA-378 was found to be the most DE and strongly associated miRNA with backfat thickness. [score:1]
Figure 3 Hypothesis of miR-378 in bovine adipogenesis. [score:1]
Potential role of miR-378 in bovine adipogenesis. [score:1]
[1 to 20 of 13 sentences]
3
[+] score: 40
Therefore, we hypothesized that bta-miR-378 may contribute to muscle development and differentiation by targeting CSRP3 gene in beef cattle and that bta-miR-378 could be a target for cattle breeding programs. [score:6]
Our data showed that a total of 1709 target sites of bta-miR-378 belonged to 1709 GO terms, and 61 target genes relating to skeletal and muscular system development and function were annotated within 27 GO terms. [score:6]
Additionally, recent results indicated that microRNA-378 can regulate nephronectin expression modulating osteoblast differentiation by targeting GalNT-7 [44]. [score:6]
In total, 1109, 2024, 1937 and 1693 target sites of AF-enriched miR-154c, -199a-3p, -320a and -432 were annotated with 1380, 1300, 1793 and 708 GO terms (Table S6B, S7B, S8B and S9B), and 1709 GO terms (Table S10B) were associated to 1709 target sites of AM-enriched miR-378 in the Non-Redundant database. [score:5]
The consistent expression pattern and high conservation indicated that bta-miR-378 was also likely to play the similar roles in the development of bovine muscle tissues. [score:4]
To better understand the functions of the bta-miR-378 target sites, IPA analysis was performed and several gene networks were identified. [score:3]
In network 2, bta-miR-378 targeted cysteine and glycine-rich protein 3 (CSRP3). [score:3]
And 61 target sites of AM-enriched bta-miR-378 were annotated within 27 GO terms (Table S10C). [score:3]
Table S10 Predicted targets for bta-miR-378. [score:3]
The contrastive patterns were shown by bta-miR-1, bta-miR-133a, bta-miR-378 and bta-miR-206 with 9799576, 18927, 24882 and 788710 reads in AM library as opposed to 89060, 127, 2209 and 28690 reads in AF library. [score:1]
[1 to 20 of 10 sentences]
4
[+] score: 37
In summary, by establishing the expression patterns of miRNAs and their putative targets in granulosa and theca cells of healthy and atretic follicles in cattle, we have identified a network of miRNAs including miR-199a-5p, miR-155, miR-222, miR-150, and miR-378, which we propose are involved in follicle atresia through combined targeting of genes involved in cell survival, proliferation, and differentiation; namely HIF1A and VEGFA in granulosa cells and MSH2, ETS1, JAG1, and VEGFA in theca cells. [score:7]
Our results implicate a network of miRNAs, namely, miR-199a-5p, miR-155, miR-150, and miR-378, in the downregulation of the HIF1A-VEGF effector system during atresia, with one miRNA, miR-199a-5p, simultaneously targeting both genes, as reported in other cell types [33]. [score:6]
Moreover, an effect of follicle status (P < 0.05), owing to overall higher expression levels in atretic follicles, was detected for all miRNAs except miR-21-5p and miR-378; for miR-378, an interaction approached significance (P = 0.07), reflecting higher expression levels in granulosa but not theca cells from atretic follicles. [score:5]
For completeness, our qPCR analyses also included 1 gene (MYD88), which interactions with 2 miRNAs were experimentally validated but not computationally predicted in bovine (Table 3 and Fig.  3), and 2 genes, IGF1 and PAPPA, which were computationally predicted bovine targets of 2 miRNAs (miR-222 and miR-378) and 3 miRNAs (miR-142-5p, miR-150, and miR-378), respectively, but none of which were experimentally validated in any species, ie, they were present in TargetScan but not in miRTarBase (Table 3 and Fig.  3). [score:5]
However, in the pig, miR-378 targets aromatase and progesterone receptor in granulosa cells and regulates both ovarian estradiol production and oocyte maturation [24], [25], [26]. [score:4]
This showed that all miRNAs except for miR-21-3p and miR-378 were expressed in greater abundance (between 2-fold and 25-fold) in theca than in granulosa cells (cell type, P < 0.05; Fig.  2). [score:3]
Another miRNA, miR-378, was previously shown, together with miR-21-5p, to increase in expression in subordinate and anovulatory follicles in horses [13], [14]. [score:3]
A putative involvement of miR-378 in regulating luteal cell survival in bovine has been suggested but not proven [23]. [score:2]
These involved JAG1 and miR-21-5p in theca cells, MSH2 and miR-21-5p in theca cells, and IGF1R and miR-378 in granulosa cells (Fig.  3A,B). [score:1]
Of 8 predicted medium-confidence interactions analyzed (Table 3), 4 were confirmed involving miR-155 and HIF1A in granulosa cells, miR-150 and VEGFA in both granulosa and theca cells, miR-378 and VEGFA in granulosa cells, and miR-155 and MSH2 in theca cells (Fig.  3A). [score:1]
[1 to 20 of 10 sentences]
5
[+] score: 26
Other miRNAs from this paper: bta-mir-378-1, bta-mir-96, bta-mir-378b, bta-mir-378c, bta-mir-378d
The results revealed that the bta-miR-378 reduced the luciferase reporter gene activity, indicating that bta-miR-378 suppressed expression of reporter gene. [score:5]
This result indicated that the SNP g. 34078 T>G altered the expression of INCENP mRNA by bta-miR-378. [score:3]
Huang et al. found that bta-miR-378 was highly expressed in the testis by Q-PCR and combined Solexa sequencing with bioinformatics [27]. [score:3]
In addition, microRNA expression vector of bta-miR-378 (precursor sequence agggctcctgactccaggtcctgtgtgttacctcgaaatagcactggacttggagtcagaaggcct) and negative control plasmid miR-control was constructed by the pEZX-MR04 vector according to Wang et al [11]. [score:3]
The relative miRNA and bta-miR-378 expressions in testis were determined by quantitative PCR. [score:3]
In the current study, we found that the bovine INCENP gene is a target for bta-miR-378 and the SNP g. 34078 T>G located at the seed sites of bta-miR-378. [score:3]
The single-nucleotide polymorphism (g. 34078 T>G) located in the seed region of bta-miR-378 binding to the 3′-UTR of the bovine INCENP gene. [score:1]
0162730.g006 Fig 6The single-nucleotide polymorphism (g. 34078 T>G) located in the seed region of bta-miR-378 binding to the 3′-UTR of the bovine INCENP gene. [score:1]
Luciferase activity of different genotypes at g. 34078 T>G locus showing PMIR-3′-UTR-T (wild type) or PMIR-3′-UTR-G (mutant type) construct co -transfected with miR-378. [score:1]
All results suggested that g. 34078 T>G could influence the association of bta-miR-378 and 3'UTR of INCENP (Fig 6). [score:1]
The MLTC-1 cells were co -transfected with 400 ng of pMIR-3'UTR-T or pMIR-3'UTR-G luciferase reporter plasmid, 50 ng of the internal control pRL-TK plasmid, and 400 ng of each miRNA vector (bta-miR-378 or miR-control) by using OPTI-MEM® I Medium (Invitrogen) and Lipofectamine2000 (Invitrogen) according to the manufacturer’s instructions. [score:1]
Using RNA22, a method for identifying microRNA binding sites and their corresponding heteroduplexes, we predicted that bta-miR-378 could bind to the 3'UTR of INCENP when g. 34078 T mutated into G. Furthermore, we predicted the minimum free energy hybridization by RNAhybrid, and the result showed that the minimum free energy of mutant type was lower than wild type, presenting that binding capacity of mutant type and bta-miR-378 was stronger than wild type. [score:1]
[1 to 20 of 12 sentences]
6
[+] score: 26
The expression of miR-378 was also significantly downregulated in prostate cancer tissues, which was identified to suppress cell growth through downregulation of MAPK1 gene involved in cell proliferation process [33]. [score:11]
In the present study, the downregulation of bta-miR-135a, bta-miR-378 and bta-miR-184 could contribute to the decreased number of SSCs and spermatogenic alterations in cattleyak, which was consistent with the cellular distribution characteristics in cattleyak testis revealed by histological analysis 1– 3. On the other hand, the over expression of miR-19b-3p was reported to repress the expression of USP32, RAB18 and Dusp6 involved in cell differentiation process and contribute to the inhibited proliferation and slow-downed cycle of SH-SY5Y cells [35]. [score:8]
The downregulation of bta-miR-135a, bta-miR-378 and bta-miR-184 could contribute to the decreased number of SSCs and spermatogenic alteration in cattleyak. [score:4]
To validate the expression level of DE miRNAs, stem-loop RT-qPCR was performed on 6 known miRNAs (bta-miRNA-449a/b, bta-miRNA-135, bta-miRNA-19b, bta-miRNA-378 and bta-miRNA-184) and 2 novel miRNAs (bta-novel 10 and bta-novel 11). [score:3]
[1 to 20 of 4 sentences]
7
[+] score: 23
AA, amino acid; ACACA, Acetyl-coenzyme A carboxylase alpha; ACSL1, Acyl-CoA synthetase long-chain family member 1; ACSS2, Acyl-CoA synthetase short-chain family member 2; AGPAT6, 1-acylglycerol-3-phosphate O-acyltransferase 6; DGAT1, diacylglycerol acyltransferase 1; EAA, essential amino acids; EIF4E, eukaryotic translation initiation factor 4E; EIF4EBP1, eukaryotic translation initiation factor 4E -binding protein 1; FA, fatty acid; FABP3, fatty acid -binding protein, heart; FASN, fatty acid synthase; GADPH, glyceraldehyde 3-phosphate dehydrogenase; INSIG1, insulin induced gene 1; LCFA, long-chain fatty acids; LPIN1, lipin 1; Mac-T, bovine mammary epithelial cells; MEC, mammary epithelial cells; MFD, milk fat-depressing diet; MIR103, microRNA 103; MIR130a, microRNA 130a; MIR21, microRNA 21; MIR27ab, microRNA 27ab; MIR34a, microRNA 34a; MIR378, microRNA 378; MIR448, microRNA 448; miRNA, microRNA; MTOR, mechanistic target of rapamycin (Ser/Thr kinase); mTORC1, mTOR complex 1; NR1H3, liver X receptor α; PPARD, peroxisome proliferator-activated receptor beta; PPARG, peroxisome proliferator-activated receptor gamma; RHEB, ras homolog enriched in brain; RIN, RNA integrity; RMC, rapamycin; RPS6KB1, ribosomal protein S6 kinase beta-1; RPS9, ribosomal protein S9; RXRA, retinoid X receptor, alpha; SCD, stearoyl-CoA desaturase; SREBF1, sterol regulatory element -binding transcription factor 1; TAG, triacylglycerol; TSC1, tuberous sclerosis 1; UXT, ubiquitously expressed prefoldin like chaperone 1: Table S1. [score:10]
Six of them (miR-199c, miR-199a-3p, miR-98, miR-378, miR-148b and miR-21-5p) were up-regulated, while 1 (miR-200a) was down-regulated. [score:7]
In the context of controlling the cellular lipogenic balance, it is noteworthy that PPARG itself alters transcription of MIR103 and MIR378, hence, these miRNA could elicit a pro-lipogenic effect through targets such as FASN [16]. [score:3]
Fig. 2Expression of MIR21, MIR27AB, MIR34A, MIR103, MIR130A, MIR378 and MIR448. [score:3]
[1 to 20 of 4 sentences]
8
[+] score: 20
Expression of miR-378 and miR-151-5p did not correlate with expression of their host genes, but this observation does not rule out the possibility that coordinated expression could still occur. [score:7]
In fact, some of these miRNAs have already been reported to play a role in adipogenesis or lipid metabolism including miR-378 which was found up-regulated in steers with high levels of subcutaneous fat [25]. [score:4]
A Pearson correlation analysis showed that expression of miR-1281 and miR-33a was correlated (p < 0.05) with their host gene, respectively, while no correlation (p > 0.05) with the host gene was observed for miR-378 and miR-151-5p (Table  2). [score:3]
Therefore, PPARGC1B expression is not the only source for miR-378, which may explain why a significant correlation was not found between miR-378 and PPARGC1B levels. [score:3]
miR-378 from miRNA 378 genes on chromosomes 4 and 7). [score:1]
For instance, miR-378 in bovine is coded in two different genomic locations, one is located in an intron of PPARGC1B gene in chromosome 7 (precursor miR-378-1) and the other in an intergenic region in chromosome 4 (precursor miR-378-2). [score:1]
The analysis included EP300 (miR-1281), PPARGC1B (miR-378), PTK2 (miR-151-5p) and SREBF2 (miR-33a). [score:1]
[1 to 20 of 7 sentences]
9
[+] score: 12
MiR-378 targets the 3´-UTR of aromatase gene (CYP19A); a gene responsible for estradiol biosynthesis in granulosa cells and inhibition of miR-378 in vitro resulted an increased estradiol production implying aromatase gene is post-transcriptionally regulated by the action of miR-378 [45]. [score:6]
While, the expression level of 30 other matured miRNAs including bta-miR-409a, bta-miR-335, bta-miR-378 and bta-miR-17-5p were significantly reduced in preovulatory dominant follicles (Table 5). [score:3]
Thus, down regulation of miR-378 in preovulatory dominant follicles may suggest increased level of aromatase gene. [score:2]
We showed bta-miR-378 to be 4-folds lower in granulosa cells of preovulatory dominant follicles in comparison with the subordinate ones. [score:1]
[1 to 20 of 4 sentences]
10
[+] score: 12
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-98, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-30b, hsa-mir-130a, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-185, hsa-mir-193a, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-181b-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-363, hsa-mir-374a, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-423, hsa-mir-20b, hsa-mir-491, hsa-mir-193b, hsa-mir-181d, hsa-mir-92b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, bta-mir-29a, bta-let-7f-2, bta-mir-148a, bta-mir-18a, bta-mir-20a, bta-mir-221, bta-mir-27a, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-30b, bta-mir-106a, bta-mir-10a, bta-mir-15b, bta-mir-181b-2, bta-mir-193a, bta-mir-20b, bta-mir-30e, bta-mir-92a-2, bta-mir-98, bta-let-7d, bta-mir-148b, bta-mir-17, bta-mir-181c, bta-mir-191, bta-mir-200c, bta-mir-22, bta-mir-29b-2, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-25, bta-mir-363, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-15a, bta-mir-19a, bta-mir-19b, bta-mir-331, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, bta-mir-1-2, bta-mir-1-1, bta-mir-130a, bta-mir-130b, bta-mir-152, bta-mir-181d, bta-mir-182, bta-mir-185, bta-mir-24-1, bta-mir-193b, bta-mir-29d, bta-mir-30f, bta-mir-339a, bta-mir-374b, bta-mir-375, bta-mir-378-1, bta-mir-491, bta-mir-92a-1, bta-mir-92b, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, bta-mir-320b, bta-mir-339b, bta-mir-19b-2, bta-mir-320a-1, bta-mir-193a-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, bta-mir-148c, hsa-mir-374c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-378j, bta-mir-378b, bta-mir-378c, bta-mir-378d, bta-mir-374c, bta-mir-148d
MiR-378 promotes osteoblast differentiation by targeting polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7 or GalNT7) [70], and miR-191 regulates erythroid differentiation in mammals by up -regulating erythroid-enriched genes Riok3 and Mxi1[71]. [score:5]
Let-7a, let-7c, miR-181b, miR-185, miR-378 and miR-423-5p were predicted to target the inducible co-stimulatory molecule (ICOS), which plays a key role in regulating T-cell differentiation, T-cell proliferation, and secretion of lymphokines, providing effective help for antibody secretion by B cells [86]. [score:4]
Notably, some miRNAs among the top 10 identified here have been reported to be related to immunity (miR-320, miR-181a, miR-30a-3p, let-7a, let-7f and let-7c) and development (miR-193a-3p, miR-378 and miR-191). [score:2]
The top 10 miRNAs were ssc-miR-193a-3p, ssc-miR-423-5p, ssc-miR-320, ssc-miR-181a, ssc-miR-30a-3p, ssc-miR-378, ssc-miR-191, ssc-let-7a, ssc-let-7f and ssc-let-7c. [score:1]
[1 to 20 of 4 sentences]
11
[+] score: 11
We selected 8 miRNAs that were reported to be upregulated (miR-145, miR-143, miR-99a-5p) or downregulated (miR-155 and miR-142-3p, miR-132, miR-378) in follicular relative to luteal tissues of ruminants [19, 21] or differentially expressed in endometrium during the human menstrual cycle (miR-31) [48– 50]. [score:9]
Out of the remaining 5 miRNAs, miR-155, miR-378 and miR-455-5p did not change (P > 0.1) during the oestrous cycle when analysed by RT-qPCR. [score:1]
We selected 8 miRNA candidates identified by sequencing (miR-125b, miR-155, miR-199a-5p, miR-381, miR-99b; Table 2) or PCR array (let-7f, miR-378, miR-455-5p; Table 3) for. [score:1]
[1 to 20 of 3 sentences]
12
[+] score: 8
Over -expression of miR-378 attenuates high glucose -suppressed osteogenic differentiation through the targeting CASP3 and activating the PI3 K/Akt pathway [32]. [score:7]
Interestingly, microRNAs with the highest changes were related to the osteogenesis of BMSC, including has-miR-146a, has-miR-135b, miR-378, miR-335-5p and miR-210. [score:1]
[1 to 20 of 2 sentences]
13
[+] score: 7
MiRNAs have also been shown to be differentially expressed in bovine adipose tissue with the expression of mir-378 expression varying with thickness of subcutaneous fat [21]. [score:7]
[1 to 20 of 1 sentences]
14
[+] score: 5
Another dairy efficiency negatively associated miRNA, miR-378, which had highest expression in the rumen under CS (Table S7), is associated with cellular proliferation and differentiation 46. [score:3]
Compared with low quality forage (CS and RS), high quality forage diet (AL) can potentially change AAs uptake by changing the expression of miRNAs associated with dairy efficiency (P < 0.05, Fig. 7) in rumen (miR-378 and -345-3p), duodenum (miR-199b), jejunum (miR-330, -425-3p, -2285p, -197, 2419-3p and 2419-5p), liver (miR-1), and mammary gland (miR-2285t and -2443), and miRNA driven phosphorylation of AAs in duodenum (miR-199b, -328, and -423-5p) and jejunum (miR-197, -2419-3p, and -2419-5p). [score:2]
[1 to 20 of 2 sentences]
15
[+] score: 5
Gerin I. Bommer G. T. McCoin C. S. Sousa K. M. Krishnan V. MacDougald O. A. Roles for miRNA-378/378* in adipocyte gene expression and lipogenesis Am. [score:3]
These included bta-miR-125b (16,807), bta-miR-16b (1023), bta-miR-92a (5157), bta-miR-378 (2098), bta-miR-940 (1435) and bta-miR-2284x (31,532). [score:1]
These miRNAs include: miR-33 [7], miR-122 [8], miR-370 [9], miR-378/378* [10], miR-27 [11], miR-143 [12], miR-335 [13], miR-103 [14] and so on. [score:1]
[1 to 20 of 3 sentences]
16
[+] score: 4
Similarly, in the present study we found differential expression of mir-29a, bomir-140, mir-199, mir-378, bomir-F0132 and bomir-F2422 in the ovarian cortical portion between fetal and adult cows. [score:3]
bomir-143-3p 22 ggo-miR-143 11 +/-UGAGAUGAAGCACUGUAGCUCG7:60268857:60268878:1 [f] Intergenic bomir-152-5p 21 hsa-miR-152 1 -CCAAGUUCUGUCAUGCACUGA19:39650399:39650419:-1 [f] Intragenicbomir-193a-2-3p [c] 19 bta-miR193a 1 -GGGACUUUGUAGGCCAGUU14:889828:889846:-1 [f] Intronic bomir-378-1-3p 21 hsa-miR-378 1 +CUGGACUUGGAGUCAGAAGGC7:60536513:60536533:1 [f] Intronic bomir-378-2-5p 21 hsa-miR-378 - - +CUGGACUUGGAGUCAGAAGGC4:11116898:11116918:1 [h] Intronic bomir-382-3p 22 hsa-miR-382 1 -GAAUCCACCACGAACAACUUC21:66031757:66031777:-1 [f] Intronic bomir-409-5p 22 hsa-miR-409 2 -GGGGUUCACCGAGCAACAUUC21:66042162:66042182:-1 [f] Intronic bomir-424-3p 22 hsa-miR-424* 1 -CAAAACGUGAGGCGCUGCUAUUn. [score:1]
[1 to 20 of 2 sentences]
17
[+] score: 4
Other miRNAs from this paper: bta-let-7f-2, bta-mir-101-2, bta-mir-103-1, bta-mir-21, bta-mir-27a, bta-mir-30d, bta-mir-320a-2, bta-mir-199a-1, bta-mir-27b, bta-mir-30b, bta-mir-107, bta-mir-140, bta-mir-30e, bta-let-7d, bta-mir-124a-1, bta-mir-199b, bta-mir-200a, bta-mir-200c, bta-let-7g, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-mir-30c, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-1-2, bta-mir-1-1, bta-mir-101-1, bta-mir-124a-2, bta-mir-124b, bta-mir-133a-2, bta-mir-133a-1, bta-mir-143, bta-mir-152, bta-mir-154a, bta-mir-185, bta-mir-199a-2, bta-mir-206, bta-mir-30f, bta-mir-335, bta-mir-33a, bta-mir-33b, bta-mir-370, bta-mir-378-1, bta-mir-432, bta-mir-9-1, bta-mir-9-2, bta-mir-1224, bta-mir-376b, bta-mir-376d, bta-mir-376c, bta-mir-376a, bta-mir-1839, bta-mir-1185, bta-mir-2284i, bta-mir-2285a, bta-mir-2284s, bta-mir-2285d, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2285b-1, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-199c, bta-mir-2284p, bta-mir-2284u, bta-mir-2363-1, bta-mir-2363-2, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2285c, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-320b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-2284e, bta-mir-320a-1, bta-mir-2284w, bta-mir-2284x, bta-mir-3432a-1, bta-mir-3432a-2, bta-mir-3604-1, bta-mir-3604-2, bta-mir-2284y-1, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2284y-2, bta-mir-378b, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2284y-3, bta-mir-154c, bta-mir-376e, bta-mir-154b, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-378c, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-6526-1, bta-mir-6526-2, bta-mir-503, bta-mir-2284y-7, bta-mir-6526-3, bta-mir-2285n-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2285k-2, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2284z-4, bta-mir-2285k-5, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-6536-1, bta-mir-2284aa-4, bta-mir-6536-2, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2284z-2, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2284ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2284ac, bta-mir-2285ae, bta-mir-378d, bta-mir-3432b, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
The overexpression of miR-378/378* during adipogenesis increases the accumulation of triacylglycerol [10]. [score:3]
In addition to miR-122, miR-370, miR-378/378*, miR-27, and miR-335 have also been recently associated with lipid metabolism and adipocyte differentiation [8]– [12]. [score:1]
[1 to 20 of 2 sentences]
18
[+] score: 4
Other miRNAs from this paper: bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-16b, bta-mir-21, bta-mir-221, bta-mir-222, bta-mir-30d, bta-mir-99a, bta-mir-145, bta-mir-181a-2, bta-mir-199a-1, bta-mir-27b, bta-mir-142, bta-mir-181b-2, bta-mir-30e, bta-mir-92a-2, bta-let-7d, bta-mir-132, bta-mir-181c, bta-mir-191, bta-mir-199b, bta-mir-214, bta-mir-29b-2, bta-mir-29c, bta-mir-455, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-let-7a-1, bta-mir-150, bta-let-7f-1, bta-mir-122, bta-let-7i, bta-mir-34c, bta-mir-363, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-195, bta-mir-34a, bta-mir-365-1, bta-mir-99b, bta-mir-100, bta-mir-129-1, bta-mir-129-2, bta-mir-130a, bta-mir-130b, bta-mir-133a-2, bta-mir-133a-1, bta-mir-143, bta-mir-146b, bta-mir-146a, bta-mir-155, bta-mir-181d, bta-mir-182, bta-mir-183, bta-mir-184, bta-mir-24-1, bta-mir-196a-2, bta-mir-196a-1, bta-mir-199a-2, bta-mir-212, bta-mir-26a-1, bta-mir-28, bta-mir-29d, bta-mir-32, bta-mir-335, bta-mir-338, bta-mir-339a, bta-mir-346, bta-mir-365-2, bta-mir-378-1, bta-mir-383, bta-mir-409a, bta-mir-449a, bta-mir-449b, bta-mir-449c, bta-mir-592, bta-mir-708, bta-mir-92a-1, bta-mir-92b, bta-mir-29e, bta-mir-29b-1, bta-mir-1271, bta-mir-1249, bta-mir-181a-1, bta-mir-181b-1, bta-mir-2285a, bta-mir-2285d, bta-mir-2285b-1, bta-mir-2332, bta-mir-199c, bta-mir-2389, bta-mir-2285c, bta-mir-2404-1, bta-mir-449d, bta-mir-2411, bta-mir-2446, bta-mir-339b, bta-mir-2404-2, bta-mir-2483, bta-mir-424, bta-mir-409b, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-378b, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-378c, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2285n-7, bta-mir-2285k-2, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2285k-5, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2285ae, bta-mir-378d, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
Indeed aromatase gene (CYP19A1) is a validated target of miR-378 [70] and this miRNA was found to be increase in granulosa cells of DF at day 7 compared to day 3 of the estrous cycle suggesting a decrease in the level of aromatase genes expression. [score:4]
[1 to 20 of 1 sentences]
19
[+] score: 4
Increased expression of mir-24-2 [68] and mir-378 [69], has been reported in serum of human patients with pulmonary tuberculosis and mir-378 increased expression was also reported in platelets of ulcerative colitis human patients [70] when compared to the healthy controls. [score:4]
[1 to 20 of 1 sentences]
20
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181a-1, hsa-mir-215, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-mir-15b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-141, hsa-mir-143, hsa-mir-152, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-184, hsa-mir-200c, hsa-mir-155, hsa-mir-29c, hsa-mir-200a, hsa-mir-99b, hsa-mir-296, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-342, hsa-mir-148b, hsa-mir-451a, ssc-mir-125b-2, ssc-mir-148a, ssc-mir-15b, ssc-mir-184, ssc-mir-224, ssc-mir-23a, ssc-mir-24-1, ssc-mir-26a, ssc-mir-29b-1, ssc-let-7f-1, ssc-mir-103-1, ssc-mir-21, ssc-mir-29c, hsa-mir-486-1, hsa-mir-499a, hsa-mir-671, hsa-mir-378d-2, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-499, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-27b, bta-mir-31, bta-mir-15b, bta-mir-215, bta-mir-30e, bta-mir-148b, bta-mir-192, bta-mir-200a, bta-mir-200c, bta-mir-23a, bta-mir-29b-2, bta-mir-29c, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-mir-342, bta-let-7f-1, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-125b-2, bta-mir-15a, bta-mir-99b, hsa-mir-664a, ssc-mir-99b, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, bta-mir-141, bta-mir-143, bta-mir-146a, bta-mir-152, bta-mir-155, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-223, bta-mir-224, bta-mir-26a-1, bta-mir-296, bta-mir-29d, bta-mir-378-1, bta-mir-451, bta-mir-486, bta-mir-671, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, ssc-mir-181a-1, ssc-mir-215, ssc-mir-30a, bta-mir-2318, bta-mir-2339, bta-mir-2430, bta-mir-664a, ssc-let-7a-1, ssc-mir-378-1, ssc-mir-29a, ssc-mir-30e, ssc-mir-499, ssc-mir-143, ssc-mir-10b, ssc-mir-486-1, ssc-mir-152, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-99a, ssc-mir-148b, ssc-mir-664, ssc-mir-192, ssc-mir-342, ssc-mir-125b-1, oar-mir-21, oar-mir-29a, oar-mir-125b, oar-mir-181a-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-296, ssc-mir-155, ssc-mir-146a, bta-mir-148c, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-486-2, hsa-mir-664b, hsa-mir-378j, ssc-let-7f-2, ssc-mir-29b-2, ssc-mir-31, ssc-mir-671, bta-mir-378b, bta-mir-378c, hsa-mir-486-2, oar-let-7a, oar-let-7f, oar-mir-103, oar-mir-10b, oar-mir-143, oar-mir-148a, oar-mir-152, oar-mir-16b, oar-mir-181a-2, oar-mir-200a, oar-mir-200b, oar-mir-200c, oar-mir-23a, oar-mir-26a, oar-mir-29b-1, oar-mir-30a, oar-mir-99a, bta-mir-664b, chi-let-7a, chi-let-7f, chi-mir-103, chi-mir-10b, chi-mir-125b, chi-mir-126, chi-mir-141, chi-mir-143, chi-mir-146a, chi-mir-148a, chi-mir-148b, chi-mir-155, chi-mir-15a, chi-mir-15b, chi-mir-16a, chi-mir-16b, chi-mir-184, chi-mir-192, chi-mir-200a, chi-mir-200b, chi-mir-200c, chi-mir-215, chi-mir-21, chi-mir-223, chi-mir-224, chi-mir-2318, chi-mir-23a, chi-mir-24, chi-mir-26a, chi-mir-27b, chi-mir-296, chi-mir-29a, chi-mir-29b, chi-mir-29c, chi-mir-30a, chi-mir-30e, chi-mir-342, chi-mir-378, chi-mir-451, chi-mir-499, chi-mir-671, chi-mir-99a, chi-mir-99b, bta-mir-378d, ssc-mir-378b, oar-mir-29b-2, ssc-mir-141, ssc-mir-200b, ssc-mir-223, bta-mir-148d
Micro -RNA378 (miR-378) regulates ovarian estradiol production by targeting aromatase. [score:4]
[1 to 20 of 1 sentences]
21
[+] score: 3
Other miRNAs from this paper: hsa-let-7c, hsa-let-7d, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-99a, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-181a-2, hsa-mir-181a-1, hsa-mir-125b-1, hsa-mir-143, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-155, hsa-mir-106b, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-151a, hsa-mir-450a-1, hsa-mir-452, hsa-mir-450a-2, hsa-mir-92b, hsa-mir-151b, hsa-mir-378d-2, bta-mir-26a-2, bta-let-7f-2, bta-mir-148a, bta-mir-151, bta-mir-16b, bta-mir-20a, bta-mir-21, bta-mir-26b, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-92a-2, bta-let-7d, bta-mir-17, bta-mir-450a-2, bta-mir-7-3, bta-let-7f-1, bta-let-7c, bta-mir-125b-2, bta-mir-15a, bta-mir-99b, hsa-mir-450b, bta-mir-106b, bta-mir-143, bta-mir-146a, bta-mir-155, bta-mir-16a, bta-mir-26a-1, bta-mir-378-1, bta-mir-452, bta-mir-92a-1, bta-mir-92b, bta-mir-7-2, bta-mir-7-1, bta-mir-181a-1, bta-mir-2284i, bta-mir-2285a, bta-mir-2284s, bta-mir-2285d, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2285b-1, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2285c, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-2284e, bta-mir-450a-1, hsa-mir-378b, bta-mir-2284w, bta-mir-2284x, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, bta-mir-450b, bta-mir-2284y-1, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, hsa-mir-378j, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2284y-2, bta-mir-378b, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2284y-3, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-378c, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2284y-7, bta-mir-2285n-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2285k-2, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2284z-4, bta-mir-2285k-5, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2284z-2, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2284ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2284ac, bta-mir-2285ae, bta-mir-378d, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
Other highly expressed microRNAs previously associated with endothelial cells included miR-21, miR-378, miR-20a, miR-17, and miR-26a [Kuehbacher et al., 2007; Wang and Olson, 2009; Bonauer et al., 2010]. [score:3]
[1 to 20 of 1 sentences]
22
[+] score: 1
Besides the abovementioned miRNAs promoting myoblast differentiation, a few identified molecules such as miR-29b [49], miR-31 [50], miR-9 [51], miR-145 [52], miR-194 [53], miR-378 [54], miR-449 [55], miR-503 [11, 27], miR-542, [56], and miR-660 [11] were described in the literature as skeletal muscle-related. [score:1]
[1 to 20 of 1 sentences]
23
[+] score: 1
In total, 22 miRNAs (bta-miR-21-5p, -miR-143, -miR-10b, -let-7i, -miR-202, -miR-148a, -let-7f, -miR-3600, -miR-99a55p, -let-7a-5p, -miR-27b, -miT-100, -let7g, -miR-26a, -miR-378, -miR-30d, -miR-125b, -450a, -miR-30e-5p, -let-7b, -miR-199a-3p, and -miR-26c) contributed to the top twenty most abundantly sequenced miRNAs in the bovine CL. [score:1]
[1 to 20 of 1 sentences]
24
[+] score: 1
MiR-378 which decreased 2.4 fold from small to large antral follicle was also reported to decrease during antral follicle growth 67 and has the ability to regulate Cyp19A1 68, critical gene for estradiol production. [score:1]
[1 to 20 of 1 sentences]