sort by

5 publications mentioning eca-mir-92a

Open access articles that are associated with the species Equus caballus and mention the gene name mir-92a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 13
miR-92a targets the EP300 TF and might block its expression. [score:5]
For example, the EP300 protein stimulated transcription of miR-92a, which in turn suppressed EP300 expression. [score:5]
For instance, EP300 might repress miR-92a expression. [score:3]
[1 to 20 of 3 sentences]
2
[+] score: 6
miRNA Mature sequence Location Potential target genes CPM per total CPM (%) eca-let-7f UGAGGUAGUAGAUUGUAUAGUU Chr23: 54150758–54150844 [–] PKD1L3, SETD9, SOS2, SRPK2, WAC 16.9 eca-let-7a UGAGGUAGUAGGUUGUAUAGUU Chr7: 29543908–29543979 [–] WAC 13.2 eca-miR-191a CAACGGAAUCCCAAAAGCAGCUG Chr16: 38001159–38001232 [+] IL13RA1, TRPM3 10.5 eca-let-7g UGAGGUAGUAGUUUGUACAGUU Chr16: 35442180–35442267 [+] ACSM3, BTRC, CDH7, RIMS2, WAC, WDR20, ZSWIM5 7.58 eca-miR-486-5p UCCUGUACUGAGCUGCCCCGAG Chr27: 3709569–3709634 [+] Not Found 5.90 eca-miR-24 UGGCUCAGUUCAGCAGGAACAG Chr7: 44930163–44930230 [+] AHDC1, AVEN, DCAF10, KANSL3, OTOP1 3.16 eca-miR-223 UGUCAGUUUGUCAAAUACCCCA ChrX: 48492588–48492691 [+] Not Found 3.07 eca-miR-21 UAGCUUAUCAGACUGAUGUUGA Chr11: 33863745–33863816 [+] ESR1, SMARCA2, ZNF800 2.91 eca-miR-92a UAUUGCACUUGUCCCGGCCUGU Chr17: 61793120–61793180 [+] STT3A 2.87 eca-miR-103 AGCAGCAUUGUACAGGGCUAUGA Chr14: 12370468–12370539 [+] Not Found 2.52 Total 68.6 (A) Venn diagram representing the numbers of miRNA species identified in the libraries. [score:3]
miRNA Mature sequence Location Potential target genes CPM per total CPM (%) eca-let-7f UGAGGUAGUAGAUUGUAUAGUU Chr23: 54150758–54150844 [–] PKD1L3, SETD9, SOS2, SRPK2, WAC 16.9 eca-let-7a UGAGGUAGUAGGUUGUAUAGUU Chr7: 29543908–29543979 [–] WAC 13.2 eca-miR-191a CAACGGAAUCCCAAAAGCAGCUG Chr16: 38001159–38001232 [+] IL13RA1, TRPM3 10.5 eca-let-7g UGAGGUAGUAGUUUGUACAGUU Chr16: 35442180–35442267 [+] ACSM3, BTRC, CDH7, RIMS2, WAC, WDR20, ZSWIM5 7.58 eca-miR-486-5p UCCUGUACUGAGCUGCCCCGAG Chr27: 3709569–3709634 [+] Not Found 5.90 eca-miR-24 UGGCUCAGUUCAGCAGGAACAG Chr7: 44930163–44930230 [+] AHDC1, AVEN, DCAF10, KANSL3, OTOP1 3.16 eca-miR-223 UGUCAGUUUGUCAAAUACCCCA ChrX: 48492588–48492691 [+] Not Found 3.07 eca-miR-21 UAGCUUAUCAGACUGAUGUUGA Chr11: 33863745–33863816 [+] ESR1, SMARCA2, ZNF800 2.91 eca-miR-92a UAUUGCACUUGUCCCGGCCUGU Chr17: 61793120–61793180 [+] STT3A 2.87 eca-miR-103 AGCAGCAUUGUACAGGGCUAUGA Chr14: 12370468–12370539 [+] Not Found 2.52 Total 68.6 As shown in the dendrogram at the top of Fig 2, samples were clustered according to tissue origins. [score:3]
[1 to 20 of 2 sentences]
3
[+] score: 6
From the four miRNAs commonly reported as showing a hemolysis-affected expression (miR-451, miR-16, miR-92a and miR-486p) [32, 39, 66] only eca-miR-486-5p (adjusted p = 2.5 × 10 [−4]) and eca-miR-16 (adjusted p = 0.011) showed a fold-change affected by the level of hemolysis. [score:3]
Of the total counts 86% were contributed by the top five most highly expressed miRNAs (eca-miR-486-5p, eca-miR-92a, eca-miR-191a, eca-miR-423-5p, eca-miR-148a). [score:3]
[1 to 20 of 2 sentences]
4
[+] score: 2
The microRNAs encoded by this cluster were grouped based on seed sequences into four families: miR-92, miR-17, miR-18 and miR-19 [37, 38] There are some examples of microRNAs with an essential impact on angiogenesis and ECM remo deling. [score:1]
The microRNAs encoded by this cluster were grouped based on seed sequences into four families: miR-92, miR-17, miR-18 and miR-19 [37, 38]There are some examples of microRNAs with an essential impact on angiogenesis and ECM remo deling. [score:1]
[1 to 20 of 2 sentences]
5
[+] score: 1
This cluster is reportedly harboring miR-17, miR-18a, miR-19a, miR-19b, miR-20a, and miR-92a, and is a well-preserved cluster in human and all vertebrates [11]– [18]. [score:1]
[1 to 20 of 1 sentences]