![]() |
miRBase |
![]() |
![]() |
![]() 6 publications mentioning eca-let-7gOpen access articles that are associated with the species Equus caballus and mention the gene name let-7g. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary. |
|
1 |
![]()
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-122, hsa-mir-140, hsa-mir-1-1, hsa-mir-486-1, hsa-mir-103b-1, hsa-mir-103b-2, eca-mir-140, eca-let-7a, eca-mir-24-1, eca-mir-1-1, eca-mir-122, eca-let-7e, eca-mir-21, eca-mir-191a, eca-mir-92a, eca-mir-1-2, eca-mir-103, eca-let-7d, eca-let-7f, eca-mir-24-2, eca-let-7c, eca-mir-486, eca-let-7a-2, eca-mir-223, hsa-mir-486-2
miRNA Mature sequence Location Potential target genes CPM per total CPM (%) eca-let-7f UGAGGUAGUAGAUUGUAUAGUU Chr23: 54150758–54150844 [–] PKD1L3, SETD9, SOS2, SRPK2, WAC 16.9 eca-let-7a UGAGGUAGUAGGUUGUAUAGUU Chr7: 29543908–29543979 [–] WAC 13.2 eca-miR-191a CAACGGAAUCCCAAAAGCAGCUG Chr16: 38001159–38001232 [+] IL13RA1, TRPM3 10.5 eca-let-7g UGAGGUAGUAGUUUGUACAGUU Chr16: 35442180–35442267 [+] ACSM3, BTRC, CDH7, RIMS2, WAC, WDR20, ZSWIM5 7.58 eca-miR-486-5p UCCUGUACUGAGCUGCCCCGAG Chr27: 3709569–3709634 [+] Not Found 5.90 eca-miR-24 UGGCUCAGUUCAGCAGGAACAG Chr7: 44930163–44930230 [+] AHDC1, AVEN, DCAF10, KANSL3, OTOP1 3.16 eca-miR-223 UGUCAGUUUGUCAAAUACCCCA ChrX: 48492588–48492691 [+] Not Found 3.07 eca-miR-21 UAGCUUAUCAGACUGAUGUUGA Chr11: 33863745–33863816 [+] ESR1, SMARCA2, ZNF800 2.91 eca-miR-92a UAUUGCACUUGUCCCGGCCUGU Chr17: 61793120–61793180 [+] STT3A 2.87 eca-miR-103 AGCAGCAUUGUACAGGGCUAUGA Chr14: 12370468–12370539 [+] Not Found 2.52 Total 68.6 As shown in the dendrogram at the top of Fig 2, samples were clustered according to tissue origins.
[score:3]
miRNA Mature sequence Location Potential target genes CPM per total CPM (%) eca-let-7f UGAGGUAGUAGAUUGUAUAGUU Chr23: 54150758–54150844 [–] PKD1L3, SETD9, SOS2, SRPK2, WAC 16.9 eca-let-7a UGAGGUAGUAGGUUGUAUAGUU Chr7: 29543908–29543979 [–] WAC 13.2 eca-miR-191a CAACGGAAUCCCAAAAGCAGCUG Chr16: 38001159–38001232 [+] IL13RA1, TRPM3 10.5 eca-let-7g UGAGGUAGUAGUUUGUACAGUU Chr16: 35442180–35442267 [+] ACSM3, BTRC, CDH7, RIMS2, WAC, WDR20, ZSWIM5 7.58 eca-miR-486-5p UCCUGUACUGAGCUGCCCCGAG Chr27: 3709569–3709634 [+] Not Found 5.90 eca-miR-24 UGGCUCAGUUCAGCAGGAACAG Chr7: 44930163–44930230 [+] AHDC1, AVEN, DCAF10, KANSL3, OTOP1 3.16 eca-miR-223 UGUCAGUUUGUCAAAUACCCCA ChrX: 48492588–48492691 [+] Not Found 3.07 eca-miR-21 UAGCUUAUCAGACUGAUGUUGA Chr11: 33863745–33863816 [+] ESR1, SMARCA2, ZNF800 2.91 eca-miR-92a UAUUGCACUUGUCCCGGCCUGU Chr17: 61793120–61793180 [+] STT3A 2.87 eca-miR-103 AGCAGCAUUGUACAGGGCUAUGA Chr14: 12370468–12370539 [+] Not Found 2.52 Total 68.6 (A) Venn diagram representing the numbers of miRNA species identified in the libraries.
[score:3]
This suggests that the 10 most abundant plasma miRNA species did not belong to the abundant miRNA group in non-plasma tissues, except for the eca-let-7 family species (S4 Table).
[score:1]
[1 to 20 of 3 sentences]
|
2 |
![]()
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-28, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, hsa-mir-197, hsa-mir-148a, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-215, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-128-1, hsa-mir-140, hsa-mir-125a, hsa-mir-155, hsa-mir-128-2, hsa-mir-361, hsa-mir-148b, hsa-mir-423, hsa-mir-425, hsa-mir-451a, hsa-mir-486-1, hsa-mir-744, hsa-mir-103b-1, hsa-mir-103b-2, eca-mir-107b, eca-mir-7-1, eca-mir-140, eca-mir-148a, eca-mir-15b, eca-mir-16-1, eca-mir-197, eca-mir-148b, eca-let-7a, eca-mir-7-2, eca-mir-30d, eca-let-7e, eca-mir-125a, eca-mir-423, eca-mir-451, eca-mir-107a, eca-mir-128-1, eca-mir-191a, eca-mir-15a, eca-mir-16-2, eca-mir-19b, eca-mir-92a, eca-mir-128-2, eca-mir-28, eca-mir-103, eca-let-7d, eca-let-7f, eca-mir-7-3, eca-let-7c, eca-mir-155, eca-mir-486, eca-let-7a-2, eca-mir-215, eca-mir-221, eca-mir-361, hsa-mir-451b, hsa-mir-486-2, eca-mir-744, eca-mir-7177b, eca-mir-425
Koh W. Sheng C. T. Tan B. Lee Q. Y. Kuznetsov V. Kiang L. S. Tanavde V. Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alphaBMC Genom.
[score:5]
The analysis with the tool edgeR showed following differenced in contrast to the analysis with DESeq2: four miRNAs were not significantly affected by the level of hemolysis (eca-miR-744, eca-miR-128, eca-miR-28-3p and eca-miR-125a-5p) and additionally five significantly affected miRNAs were reported: eca-miR-423-5p, eca-let-7g, eca-miR-19b, eca-miR-425, eca-miR-7177b (Table S6).
[score:1]
[1 to 20 of 2 sentences]
|
3 |
![]()
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, mmu-let-7g, mmu-let-7i, mmu-let-7d, hsa-let-7g, hsa-let-7i, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, eca-let-7a, eca-let-7e, eca-let-7d, eca-let-7f, eca-let-7c, eca-let-7a-2, mmu-let-7j, mmu-let-7k, chi-let-7a, chi-let-7b, chi-let-7c, chi-let-7d, chi-let-7e, chi-let-7f, chi-let-7g, chi-let-7i, ocu-let-7a-1, ocu-let-7a-2, ocu-let-7a-3, ocu-let-7b, ocu-let-7c, ocu-let-7d, ocu-let-7f-1, ocu-let-7f-2, ocu-let-7g, ocu-let-7i
It inhibits the processing of microRNAs (miRNAs) into mature miRNAs by binding to the terminal loops of miRNA precursors such as let-7 family members [6].
[score:3]
The let-7 family of microRNAs.
[score:1]
Lin-28 interaction with the Let-7 precursor loop mediates regulated microRNA processing.
[score:1]
[1 to 20 of 3 sentences]
|
4 |
![]()
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-30a, hsa-mir-30c-2, hsa-mir-30d, hsa-let-7g, hsa-let-7i, hsa-mir-30b, hsa-mir-30c-1, hsa-mir-30e, eca-mir-30c, eca-mir-30e, eca-let-7a, eca-mir-30b, eca-mir-30d, eca-let-7e, eca-mir-21, eca-mir-30c-2, eca-let-7d, eca-let-7f, eca-let-7c, eca-let-7a-2
In the present study, two members of the let-7 family of miRNAs, let-7d-3p and let-7d-5p, and miR-21-5p had increased expression following exercise.
[score:3]
The Let-7 family of miRNAs are involved in the regulation of glucose homeostasis and insulin sensitivity [43], both key processes in energy metabolism during exercise.
[score:2]
[1 to 20 of 2 sentences]
|
5 |
![]()
Other miRNAs from this paper: hsa-mir-16-1, hsa-mir-18a, hsa-mir-21, hsa-mir-26a-1, hsa-mir-96, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-148a, hsa-mir-181a-2, hsa-mir-187, hsa-mir-181a-1, hsa-let-7g, hsa-mir-125b-1, hsa-mir-132, hsa-mir-142, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-150, hsa-mir-155, hsa-mir-26a-2, hsa-mir-449a, hsa-mir-146b, hsa-mir-103b-1, hsa-mir-103b-2, eca-mir-146b, eca-mir-148a, eca-mir-96, eca-mir-16-1, eca-mir-9a, eca-mir-26a, eca-mir-125b, eca-mir-187, eca-mir-150, eca-mir-132, eca-mir-142, eca-mir-21, eca-mir-146a, eca-mir-9a-2, eca-mir-191a, eca-mir-16-2, eca-mir-18a, eca-mir-449a, eca-mir-103, eca-mir-181a, eca-mir-155
In a study of human patients with liver disease and healthy controls, miR-21 was the most abundant in PBMCs from all donors, while the second most abundant in eight of twelve samples was either let-7g or miR-26a (ranked second and third in horses) [35].
[score:3]
For example, let-7g, miR-21 and miR-191a are among the most abundant miRNAs in both PBMCs and plasma of horses, while miR-150 features prominently in PBMCs and whole blood.
[score:1]
[1 to 20 of 2 sentences]
|
6 |
![]()
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-26a-1, hsa-mir-26b, hsa-let-7g, hsa-let-7i, hsa-mir-143, hsa-mir-154, hsa-mir-26a-2, hsa-mir-377, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-26a, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-let-7a-2, gga-let-7j, gga-let-7k, ssc-mir-26a, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-21, hsa-mir-494, bta-mir-26a-2, bta-let-7f-2, bta-mir-21, bta-mir-26b, gga-mir-21, bta-let-7d, bta-let-7g, bta-let-7a-1, bta-let-7f-1, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-143, bta-mir-154a, bta-mir-26a-1, bta-mir-377, bta-mir-494, eca-mir-26a, eca-let-7a, eca-let-7e, eca-mir-21, eca-mir-143, eca-mir-26a-2, eca-let-7d, eca-let-7f, eca-mir-154a, eca-mir-377, eca-mir-494, eca-let-7c, eca-let-7a-2, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-143, ssc-mir-494, bta-mir-26c, ssc-let-7a-2, ssc-let-7d, ssc-let-7f-2, bta-mir-154c, bta-mir-154b, eca-mir-154b, gga-mir-26a-2, ssc-mir-26b, gga-mir-143, gga-let-7l-1, gga-let-7l-2
The discovery of the regulatory miRNA let-7 in C. elegans in 2000 [10], with homologs in other species including humans, caused researchers to reconsider the idea that miRNAs may have a more widespread function within cells.
[score:2]
[1 to 20 of 1 sentences]
|