sort by

6 publications mentioning eca-mir-21

Open access articles that are associated with the species Equus caballus and mention the gene name mir-21. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 21
In contrast, the up-regulation of miR-21 expression in HCC tissues promotes tumorigenesis as well as resistance to antitumor 5FU and interferon α combination therapy [30]. [score:6]
We have revealed common small non-coding RNA molecules (miR-26a, miR-195, miR- miR-126, miR-122, miR-21, miR-155, miR-9, miR-135b, miR-29b, miR-142-3p, miR-210, miR-181, miR- 224) in HCC and CRC, which suppress the expression of multiple genes involved in tumor- stromal interactions, immune invasion and tumor angiogenesis. [score:5]
Tumorigenesis in CRC E-cadherin[41, 42] miR-135b HCC cell metastasis; CRC proliferation HSF1, MSH2[44, 45] miR-29b Apoptosis promotion Bcl-2 and Mcl-1, MMP-2[47, 48] miR-142-3p HCC and CRC proliferation RAC1, CD 133, Lgr 5, ABCG2[60, 62, 107] miR-210 HCC metastasis; overexpressed in CRC VMP1, CPEB2[51, 52] miR- 181a Oncogenic role in HCC; poor survival in patients with CRC CDX2, GATA6, NLK, EGFR[64, 65] miR- 224 Oncogenic role in HCC; prognostic marker in CRC SMAD4, API-5[49, 63]Previous studies indicated that miR-34a inhibits tumor growth, miR-21 promotes apoptosis resistance of tumor cells proliferation while the miR-200 family is strongly associated with the epithelial- mesenchymal transition (EMT) [18, 19]. [score:5]
Tumorigenesis in CRC E-cadherin[41, 42] miR-135b HCC cell metastasis; CRC proliferation HSF1, MSH2[44, 45] miR-29b Apoptosis promotion Bcl-2 and Mcl-1, MMP-2[47, 48] miR-142-3p HCC and CRC proliferation RAC1, CD 133, Lgr 5, ABCG2[60, 62, 107] miR-210 HCC metastasis; overexpressed in CRC VMP1, CPEB2[51, 52] miR- 181a Oncogenic role in HCC; poor survival in patients with CRC CDX2, GATA6, NLK, EGFR[64, 65] miR- 224 Oncogenic role in HCC; prognostic marker in CRC SMAD4, API-5[49, 63] Previous studies indicated that miR-34a inhibits tumor growth, miR-21 promotes apoptosis resistance of tumor cells proliferation while the miR-200 family is strongly associated with the epithelial- mesenchymal transition (EMT) [18, 19]. [score:5]
[1 to 20 of 4 sentences]
2
[+] score: 17
Interestingly, we confirmed the post-exercise expression of miR-21-5p and their target DEGs. [score:5]
The expression of miR-21-5p is known to be stress-responsive; this miRNA has an important role in heart failure 40, renal ischemia reperfusion injury 41, and in the self-protective anti-inflammatory reaction to exercise 22. [score:3]
Baggish et al. 13 suggested that human miR-20a, miR-21 and miR-221 (i) are released after exercise into the bloodstream by tissues other than blood cells and (ii) may regulate key pathways in angiogenesis, inflammation, muscle contractibility and adaptation to hypoxia. [score:2]
At T1, miR-21-5p displayed a p-value < 0.05 for both R [2] and MSE; this miRNA was not predicted by either R [2] or MSE at T0, suggesting that it might be involved in the regulation of exercise-related physiological processes (Fig. 8). [score:2]
By using various computational methods and an independent cohort of animals, we confirmed that miR-21-5p, miR-181b-5p and miR-505-5p are putative regulators of the response to endurance exercise. [score:2]
For example, miR-21, miR-27a and miR-181 were found to be DE in the whole blood of highly trained human athletes after a 30-minute treadmill test 22. [score:1]
Accordingly, levels of miR-20a, miR-21 and miR-221 were not correlated with changes in plasma markers of muscle inflammation and liver damage. [score:1]
Similarly, we observed an enrichment of miR-20ab, miR-21, miR-103a-3p, miR-107 and miR-221 when comparing pre- and post-ride blood samples. [score:1]
[1 to 20 of 8 sentences]
3
[+] score: 10
In the present study, two members of the let-7 family of miRNAs, let-7d-3p and let-7d-5p, and miR-21-5p had increased expression following exercise. [score:3]
In skeletal muscle samples, 97/179 miRNAs were detected with 5 miRNAs (miR-21-5p, let-7d-3p, let-7d-5p, miR-30b-5p, miR-30e-5p) differentially expressed (DE, P < 0.05) between time-points. [score:3]
The greatest expression difference was detected in miRNA miR-21-5p which increased 0.92 ± 0.2 fold. [score:3]
Accession numbers for the miRNA data generated in this study are: MIMAT0004484 (hsa-let-7d-3p), MIMAT0000076 (hsa-miR-21-5p), MIMAT0000065 (hsa-let-7d-5p), MIMAT0000420 (hsa-miR-30b-5p) and MIMAT0000692 (hsa-miR-30e-5p). [score:1]
[1 to 20 of 4 sentences]
4
[+] score: 9
miRNA Mature sequence Location Potential target genes CPM per total CPM (%) eca-let-7f UGAGGUAGUAGAUUGUAUAGUU Chr23: 54150758–54150844 [–] PKD1L3, SETD9, SOS2, SRPK2, WAC 16.9 eca-let-7a UGAGGUAGUAGGUUGUAUAGUU Chr7: 29543908–29543979 [–] WAC 13.2 eca-miR-191a CAACGGAAUCCCAAAAGCAGCUG Chr16: 38001159–38001232 [+] IL13RA1, TRPM3 10.5 eca-let-7g UGAGGUAGUAGUUUGUACAGUU Chr16: 35442180–35442267 [+] ACSM3, BTRC, CDH7, RIMS2, WAC, WDR20, ZSWIM5 7.58 eca-miR-486-5p UCCUGUACUGAGCUGCCCCGAG Chr27: 3709569–3709634 [+] Not Found 5.90 eca-miR-24 UGGCUCAGUUCAGCAGGAACAG Chr7: 44930163–44930230 [+] AHDC1, AVEN, DCAF10, KANSL3, OTOP1 3.16 eca-miR-223 UGUCAGUUUGUCAAAUACCCCA ChrX: 48492588–48492691 [+] Not Found 3.07 eca-miR-21 UAGCUUAUCAGACUGAUGUUGA Chr11: 33863745–33863816 [+] ESR1, SMARCA2, ZNF800 2.91 eca-miR-92a UAUUGCACUUGUCCCGGCCUGU Chr17: 61793120–61793180 [+] STT3A 2.87 eca-miR-103 AGCAGCAUUGUACAGGGCUAUGA Chr14: 12370468–12370539 [+] Not Found 2.52 Total 68.6 (A) Venn diagram representing the numbers of miRNA species identified in the libraries. [score:3]
Seven miRNA species, eca-miR-21, -24, -92a, -191a, -223, -486-5p, and -103, were found to have significantly higher expression levels in the plasma than the three other tissues (P < 0.05). [score:3]
miRNA Mature sequence Location Potential target genes CPM per total CPM (%) eca-let-7f UGAGGUAGUAGAUUGUAUAGUU Chr23: 54150758–54150844 [–] PKD1L3, SETD9, SOS2, SRPK2, WAC 16.9 eca-let-7a UGAGGUAGUAGGUUGUAUAGUU Chr7: 29543908–29543979 [–] WAC 13.2 eca-miR-191a CAACGGAAUCCCAAAAGCAGCUG Chr16: 38001159–38001232 [+] IL13RA1, TRPM3 10.5 eca-let-7g UGAGGUAGUAGUUUGUACAGUU Chr16: 35442180–35442267 [+] ACSM3, BTRC, CDH7, RIMS2, WAC, WDR20, ZSWIM5 7.58 eca-miR-486-5p UCCUGUACUGAGCUGCCCCGAG Chr27: 3709569–3709634 [+] Not Found 5.90 eca-miR-24 UGGCUCAGUUCAGCAGGAACAG Chr7: 44930163–44930230 [+] AHDC1, AVEN, DCAF10, KANSL3, OTOP1 3.16 eca-miR-223 UGUCAGUUUGUCAAAUACCCCA ChrX: 48492588–48492691 [+] Not Found 3.07 eca-miR-21 UAGCUUAUCAGACUGAUGUUGA Chr11: 33863745–33863816 [+] ESR1, SMARCA2, ZNF800 2.91 eca-miR-92a UAUUGCACUUGUCCCGGCCUGU Chr17: 61793120–61793180 [+] STT3A 2.87 eca-miR-103 AGCAGCAUUGUACAGGGCUAUGA Chr14: 12370468–12370539 [+] Not Found 2.52 Total 68.6 As shown in the dendrogram at the top of Fig 2, samples were clustered according to tissue origins. [score:3]
[1 to 20 of 3 sentences]
5
[+] score: 4
In a study of human patients with liver disease and healthy controls, miR-21 was the most abundant in PBMCs from all donors, while the second most abundant in eight of twelve samples was either let-7g or miR-26a (ranked second and third in horses) [35]. [score:3]
For example, let-7g, miR-21 and miR-191a are among the most abundant miRNAs in both PBMCs and plasma of horses, while miR-150 features prominently in PBMCs and whole blood. [score:1]
[1 to 20 of 2 sentences]
6
[+] score: 3
For example, hsa-miR-21-5p has been documented in nearly 400 Pubmed articles and is associated with 124 human disease phenotypes and has homologs in four animals including chicken. [score:3]
[1 to 20 of 1 sentences]