![]() |
miRBase |
![]() |
![]() |
![]() 6 publications mentioning eca-let-7aOpen access articles that are associated with the species Equus caballus and mention the gene name let-7a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary. |
|
1 |
![]()
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-122, hsa-mir-140, hsa-mir-1-1, hsa-mir-486-1, hsa-mir-103b-1, hsa-mir-103b-2, eca-mir-140, eca-mir-24-1, eca-mir-1-1, eca-mir-122, eca-let-7e, eca-mir-21, eca-let-7g, eca-mir-191a, eca-mir-92a, eca-mir-1-2, eca-mir-103, eca-let-7d, eca-let-7f, eca-mir-24-2, eca-let-7c, eca-mir-486, eca-let-7a-2, eca-mir-223, hsa-mir-486-2
The expression levels for eca-let-7f and -7g did not differ significantly among the four tissue types, whereas eca-let-7a expression was significantly lower in the plasma (P < 0.05).
[score:5]
miRNA Mature sequence Location Potential target genes CPM per total CPM (%) eca-let-7f UGAGGUAGUAGAUUGUAUAGUU Chr23: 54150758–54150844 [–] PKD1L3, SETD9, SOS2, SRPK2, WAC 16.9 eca-let-7a UGAGGUAGUAGGUUGUAUAGUU Chr7: 29543908–29543979 [–] WAC 13.2 eca-miR-191a CAACGGAAUCCCAAAAGCAGCUG Chr16: 38001159–38001232 [+] IL13RA1, TRPM3 10.5 eca-let-7g UGAGGUAGUAGUUUGUACAGUU Chr16: 35442180–35442267 [+] ACSM3, BTRC, CDH7, RIMS2, WAC, WDR20, ZSWIM5 7.58 eca-miR-486-5p UCCUGUACUGAGCUGCCCCGAG Chr27: 3709569–3709634 [+] Not Found 5.90 eca-miR-24 UGGCUCAGUUCAGCAGGAACAG Chr7: 44930163–44930230 [+] AHDC1, AVEN, DCAF10, KANSL3, OTOP1 3.16 eca-miR-223 UGUCAGUUUGUCAAAUACCCCA ChrX: 48492588–48492691 [+] Not Found 3.07 eca-miR-21 UAGCUUAUCAGACUGAUGUUGA Chr11: 33863745–33863816 [+] ESR1, SMARCA2, ZNF800 2.91 eca-miR-92a UAUUGCACUUGUCCCGGCCUGU Chr17: 61793120–61793180 [+] STT3A 2.87 eca-miR-103 AGCAGCAUUGUACAGGGCUAUGA Chr14: 12370468–12370539 [+] Not Found 2.52 Total 68.6 (A) Venn diagram representing the numbers of miRNA species identified in the libraries.
[score:3]
miRNA Mature sequence Location Potential target genes CPM per total CPM (%) eca-let-7f UGAGGUAGUAGAUUGUAUAGUU Chr23: 54150758–54150844 [–] PKD1L3, SETD9, SOS2, SRPK2, WAC 16.9 eca-let-7a UGAGGUAGUAGGUUGUAUAGUU Chr7: 29543908–29543979 [–] WAC 13.2 eca-miR-191a CAACGGAAUCCCAAAAGCAGCUG Chr16: 38001159–38001232 [+] IL13RA1, TRPM3 10.5 eca-let-7g UGAGGUAGUAGUUUGUACAGUU Chr16: 35442180–35442267 [+] ACSM3, BTRC, CDH7, RIMS2, WAC, WDR20, ZSWIM5 7.58 eca-miR-486-5p UCCUGUACUGAGCUGCCCCGAG Chr27: 3709569–3709634 [+] Not Found 5.90 eca-miR-24 UGGCUCAGUUCAGCAGGAACAG Chr7: 44930163–44930230 [+] AHDC1, AVEN, DCAF10, KANSL3, OTOP1 3.16 eca-miR-223 UGUCAGUUUGUCAAAUACCCCA ChrX: 48492588–48492691 [+] Not Found 3.07 eca-miR-21 UAGCUUAUCAGACUGAUGUUGA Chr11: 33863745–33863816 [+] ESR1, SMARCA2, ZNF800 2.91 eca-miR-92a UAUUGCACUUGUCCCGGCCUGU Chr17: 61793120–61793180 [+] STT3A 2.87 eca-miR-103 AGCAGCAUUGUACAGGGCUAUGA Chr14: 12370468–12370539 [+] Not Found 2.52 Total 68.6 As shown in the dendrogram at the top of Fig 2, samples were clustered according to tissue origins.
[score:3]
WW domain containing adaptor with coiled-coil (WAC) mRNA was shown to be a putative common target of three of the miRNA species with nearly identical sequences: eca-let-7a, -7f, and -7g.
[score:3]
This suggests that the 10 most abundant plasma miRNA species did not belong to the abundant miRNA group in non-plasma tissues, except for the eca-let-7 family species (S4 Table).
[score:1]
[1 to 20 of 5 sentences]
|
2 |
![]()
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-210, hsa-mir-181a-1, hsa-mir-224, hsa-mir-200b, hsa-mir-122, hsa-mir-142, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-195, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-29c, hsa-mir-200a, hsa-mir-26a-2, hsa-mir-135b, hsa-mir-18b, hsa-mir-181d, hsa-mir-92b, hsa-mir-675, eca-mir-200a, eca-mir-200b, eca-mir-34a, eca-mir-29a, eca-mir-29b, eca-mir-135b, eca-mir-29b-2, eca-mir-29c, eca-mir-29c-2, eca-mir-92b, eca-mir-9a, eca-mir-200c, eca-mir-26a, eca-mir-100, eca-mir-122, eca-mir-142, eca-mir-195, eca-mir-21, eca-mir-675, eca-mir-145, eca-mir-9a-2, eca-mir-26a-2, eca-mir-17, eca-mir-18a, eca-mir-19a, eca-mir-19b, eca-mir-92a, eca-mir-126, eca-mir-181a, eca-mir-181b, eca-mir-155, eca-mir-181a-2, eca-mir-18b, eca-mir-19b-2, eca-mir-224, eca-mir-92a-2
On the other hand, transiently transfected human embryonic kidney cells were used to set up exosomes loaded with let-7a, a crucial tumor suppressor miRNA that is down-regulated in breast cancer [1, 15, 54].
[score:6]
[1 to 20 of 1 sentences]
|
3 |
![]()
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, mmu-let-7g, mmu-let-7i, mmu-let-7d, hsa-let-7g, hsa-let-7i, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, eca-let-7e, eca-let-7g, eca-let-7d, eca-let-7f, eca-let-7c, eca-let-7a-2, mmu-let-7j, mmu-let-7k, chi-let-7a, chi-let-7b, chi-let-7c, chi-let-7d, chi-let-7e, chi-let-7f, chi-let-7g, chi-let-7i, ocu-let-7a-1, ocu-let-7a-2, ocu-let-7a-3, ocu-let-7b, ocu-let-7c, ocu-let-7d, ocu-let-7f-1, ocu-let-7f-2, ocu-let-7g, ocu-let-7i
It inhibits the processing of microRNAs (miRNAs) into mature miRNAs by binding to the terminal loops of miRNA precursors such as let-7 family members [6].
[score:3]
The let-7 family of microRNAs.
[score:1]
Lin-28 interaction with the Let-7 precursor loop mediates regulated microRNA processing.
[score:1]
[1 to 20 of 3 sentences]
|
4 |
![]()
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-30a, hsa-mir-30c-2, hsa-mir-30d, hsa-let-7g, hsa-let-7i, hsa-mir-30b, hsa-mir-30c-1, hsa-mir-30e, eca-mir-30c, eca-mir-30e, eca-mir-30b, eca-mir-30d, eca-let-7e, eca-mir-21, eca-let-7g, eca-mir-30c-2, eca-let-7d, eca-let-7f, eca-let-7c, eca-let-7a-2
In the present study, two members of the let-7 family of miRNAs, let-7d-3p and let-7d-5p, and miR-21-5p had increased expression following exercise.
[score:3]
The Let-7 family of miRNAs are involved in the regulation of glucose homeostasis and insulin sensitivity [43], both key processes in energy metabolism during exercise.
[score:2]
[1 to 20 of 2 sentences]
|
5 |
![]()
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-28, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, hsa-mir-197, hsa-mir-148a, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-215, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-128-1, hsa-mir-140, hsa-mir-125a, hsa-mir-155, hsa-mir-128-2, hsa-mir-361, hsa-mir-148b, hsa-mir-423, hsa-mir-425, hsa-mir-451a, hsa-mir-486-1, hsa-mir-744, hsa-mir-103b-1, hsa-mir-103b-2, eca-mir-107b, eca-mir-7-1, eca-mir-140, eca-mir-148a, eca-mir-15b, eca-mir-16-1, eca-mir-197, eca-mir-148b, eca-mir-7-2, eca-mir-30d, eca-let-7e, eca-mir-125a, eca-mir-423, eca-mir-451, eca-mir-107a, eca-let-7g, eca-mir-128-1, eca-mir-191a, eca-mir-15a, eca-mir-16-2, eca-mir-19b, eca-mir-92a, eca-mir-128-2, eca-mir-28, eca-mir-103, eca-let-7d, eca-let-7f, eca-mir-7-3, eca-let-7c, eca-mir-155, eca-mir-486, eca-let-7a-2, eca-mir-215, eca-mir-221, eca-mir-361, hsa-mir-451b, hsa-mir-486-2, eca-mir-744, eca-mir-7177b, eca-mir-425
Koh W. Sheng C. T. Tan B. Lee Q. Y. Kuznetsov V. Kiang L. S. Tanavde V. Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alphaBMC Genom.
[score:5]
[1 to 20 of 1 sentences]
|
6 |
![]()
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-26a-1, hsa-mir-26b, hsa-let-7g, hsa-let-7i, hsa-mir-143, hsa-mir-154, hsa-mir-26a-2, hsa-mir-377, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-26a, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-let-7a-2, gga-let-7j, gga-let-7k, ssc-mir-26a, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-21, hsa-mir-494, bta-mir-26a-2, bta-let-7f-2, bta-mir-21, bta-mir-26b, gga-mir-21, bta-let-7d, bta-let-7g, bta-let-7a-1, bta-let-7f-1, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-143, bta-mir-154a, bta-mir-26a-1, bta-mir-377, bta-mir-494, eca-mir-26a, eca-let-7e, eca-mir-21, eca-mir-143, eca-let-7g, eca-mir-26a-2, eca-let-7d, eca-let-7f, eca-mir-154a, eca-mir-377, eca-mir-494, eca-let-7c, eca-let-7a-2, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-143, ssc-mir-494, bta-mir-26c, ssc-let-7a-2, ssc-let-7d, ssc-let-7f-2, bta-mir-154c, bta-mir-154b, eca-mir-154b, gga-mir-26a-2, ssc-mir-26b, gga-mir-143, gga-let-7l-1, gga-let-7l-2
The discovery of the regulatory miRNA let-7 in C. elegans in 2000 [10], with homologs in other species including humans, caused researchers to reconsider the idea that miRNAs may have a more widespread function within cells.
[score:2]
[1 to 20 of 1 sentences]
|